Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401606597:

Variant ID: vg0401606597 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1606597
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAAAAATCCTTGCCTTCTTTTTGGGTATAACCCTTGGCCACGAGCCTTGCCTTGTACATTTCAATTGTACCATCAGGCCTAAGCTTTTTCTTGAAAAC[C/T]
CATTTGCATCCTACAGGCTTGCACCCATATGGATGCTCAACGACTTCTCAAGTACCATTAGACATAATTGAGTCTATCTCACTGCGTACTGCTTCCTTCC

Reverse complement sequence

GGAAGGAAGCAGTACGCAGTGAGATAGACTCAATTATGTCTAATGGTACTTGAGAAGTCGTTGAGCATCCATATGGGTGCAAGCCTGTAGGATGCAAATG[G/A]
GTTTTCAAGAAAAAGCTTAGGCCTGATGGTACAATTGAAATGTACAAGGCAAGGCTCGTGGCCAAGGGTTATACCCAAAAAGAAGGCAAGGATTTTTCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.10%	14.30%	0.66%	63.99%	NA
All Indica	2759	13.80%	21.30%	0.98%	63.86%	NA
All Japonica	1512	37.00%	2.10%	0.20%	60.71%	NA
Aus	269	11.50%	1.50%	0.00%	86.99%	NA
Indica I	595	32.30%	2.20%	1.68%	63.87%	NA
Indica II	465	8.00%	33.50%	0.43%	58.06%	NA
Indica III	913	4.60%	34.30%	0.66%	60.46%	NA
Indica Intermediate	786	14.10%	13.50%	1.15%	71.25%	NA
Temperate Japonica	767	57.10%	0.30%	0.13%	42.50%	NA
Tropical Japonica	504	8.50%	4.40%	0.20%	86.90%	NA
Japonica Intermediate	241	32.80%	2.90%	0.41%	63.90%	NA
VI/Aromatic	96	1.00%	42.70%	0.00%	56.25%	NA
Intermediate	90	24.40%	12.20%	1.11%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401606597	C -> DEL	N	N	silent_mutation	Average:11.776; most accessible tissue: Callus, score: 18.419	N	N	N	N
vg0401606597	C -> T	LOC_Os04g03630.1	upstream_gene_variant ; 3034.0bp to feature; MODIFIER	silent_mutation	Average:11.776; most accessible tissue: Callus, score: 18.419	N	N	N	N
vg0401606597	C -> T	LOC_Os04g03650.1	upstream_gene_variant ; 4316.0bp to feature; MODIFIER	silent_mutation	Average:11.776; most accessible tissue: Callus, score: 18.419	N	N	N	N
vg0401606597	C -> T	LOC_Os04g03640.1	intron_variant ; MODIFIER	silent_mutation	Average:11.776; most accessible tissue: Callus, score: 18.419	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401606597	NA	4.13E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401606597	NA	1.16E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401606597	NA	5.25E-06	mr1606	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401606597	NA	2.73E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401606597	NA	3.90E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401606597	NA	2.50E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401606597	NA	1.85E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251