Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401247859:

Variant ID: vg0401247859 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1247859
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCCTGTACTAGTGCTTTTGACTGTGCACATATCATTTATTGGACCTGTCCTACATCCACCCATTATGTTGCTATAAACAACAAGTGGTACAAATTTT[G/T]
TACTCCCTCCGTATTTTAATGTATGACGACGTTGACTTTTCGACCTACGTTTGACCATTCGCCATATTCAAAAATTTTATGCAAATATGAAAATATTTAT

Reverse complement sequence

ATAAATATTTTCATATTTGCATAAAATTTTTGAATATGGCGAATGGTCAAACGTAGGTCGAAAAGTCAACGTCGTCATACATTAAAATACGGAGGGAGTA[C/A]
AAAATTTGTACCACTTGTTGTTTATAGCAACATAATGGGTGGATGTAGGACAGGTCCAATAAATGATATGTGCACAGTCAAAAGCACTAGTACAGGGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 16.70% 1.99% 14.96% NA
All Indica  2759 62.20% 27.30% 3.12% 7.47% NA
All Japonica  1512 67.30% 0.40% 0.33% 32.01% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 91.90% 6.20% 0.67% 1.18% NA
Indica II  465 28.80% 51.00% 0.86% 19.35% NA
Indica III  913 65.60% 19.50% 6.13% 8.76% NA
Indica Intermediate  786 55.30% 38.20% 2.80% 3.69% NA
Temperate Japonica  767 59.80% 0.10% 0.39% 39.63% NA
Tropical Japonica  504 76.80% 0.60% 0.20% 22.42% NA
Japonica Intermediate  241 71.00% 0.80% 0.41% 27.80% NA
VI/Aromatic  96 92.70% 2.10% 1.04% 4.17% NA
Intermediate  90 55.60% 28.90% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401247859 G -> DEL N N silent_mutation Average:48.006; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0401247859 G -> T LOC_Os04g03040.1 upstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:48.006; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0401247859 G -> T LOC_Os04g03050.1 upstream_gene_variant ; 591.0bp to feature; MODIFIER silent_mutation Average:48.006; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0401247859 G -> T LOC_Os04g03040-LOC_Os04g03050 intergenic_region ; MODIFIER silent_mutation Average:48.006; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401247859 G T 0.03 -0.02 0.02 0.01 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401247859 NA 5.06E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 8.07E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 1.55E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 1.02E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 6.76E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 8.63E-07 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 1.09E-09 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 2.59E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 1.79E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 8.46E-07 mr1348_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 8.07E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 3.44E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 3.93E-06 2.52E-06 mr1525_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401247859 NA 8.21E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251