Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401153559:

Variant ID: vg0401153559 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1153559
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGTGTATTTAGAGCAAGTTTAATAGTATAGCCAACTAATAGCTCTAATTTATCTATAGCTAATCTAATAGCTCATTTATACAATAGATACATACTACA[C/T]
TATTAATACTTGGTCCCACTAGTCATACACACATTGTGTCTTGGAGTCCGTGCTACAGCTGACTATAAATCTGTAGCCTGCTGCTCTTTTCTCTCCTCAT

Reverse complement sequence

ATGAGGAGAGAAAAGAGCAGCAGGCTACAGATTTATAGTCAGCTGTAGCACGGACTCCAAGACACAATGTGTGTATGACTAGTGGGACCAAGTATTAATA[G/A]
TGTAGTATGTATCTATTGTATAAATGAGCTATTAGATTAGCTATAGATAAATTAGAGCTATTAGTTGGCTATACTATTAAACTTGCTCTAAATACACTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	46.20%	0.13%	0.00%	NA
All Indica	2759	57.90%	42.10%	0.00%	0.00%	NA
All Japonica	1512	40.30%	59.50%	0.26%	0.00%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	24.50%	75.50%	0.00%	0.00%	NA
Indica II	465	73.30%	26.70%	0.00%	0.00%	NA
Indica III	913	64.50%	35.50%	0.00%	0.00%	NA
Indica Intermediate	786	66.40%	33.60%	0.00%	0.00%	NA
Temperate Japonica	767	10.00%	89.60%	0.39%	0.00%	NA
Tropical Japonica	504	78.20%	21.80%	0.00%	0.00%	NA
Japonica Intermediate	241	57.30%	42.30%	0.41%	0.00%	NA
VI/Aromatic	96	17.70%	81.20%	1.04%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401153559	C -> T	LOC_Os04g02910.1	upstream_gene_variant ; 1340.0bp to feature; MODIFIER	silent_mutation	Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541	N	N	N	N
vg0401153559	C -> T	LOC_Os04g02910.3	upstream_gene_variant ; 2132.0bp to feature; MODIFIER	silent_mutation	Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541	N	N	N	N
vg0401153559	C -> T	LOC_Os04g02910.4	upstream_gene_variant ; 1340.0bp to feature; MODIFIER	silent_mutation	Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541	N	N	N	N
vg0401153559	C -> T	LOC_Os04g02910-LOC_Os04g02920	intergenic_region ; MODIFIER	silent_mutation	Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0401153559	C	T	0.0	-0.03	-0.03	-0.02	-0.03	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401153559	NA	8.89E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	3.04E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	5.62E-10	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	9.49E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	6.65E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	1.63E-08	6.78E-09	mr1878	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	8.41E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	8.66E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	3.32E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	3.99E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	5.49E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	8.87E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559	NA	1.66E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251