Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401115443:

Variant ID: vg0401115443 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1115443
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCATCGCCATTGGTAGCGTGAGCGATCAGTTCAACACCGCTCAACAACTATTCGACAAAACACCTTCAAGGCATCTCCCTGGCCCTTGTGATTCCTGG[C/T]
TGGCTGGCTGGTTGCGAAGAATTAATTCAGGTTCCTTCTCTCGTATCTCTTAGATTAATTTGATGGGTGGTTTCGATTTCATACTTCCATAAGAAGGGTG

Reverse complement sequence

CACCCTTCTTATGGAAGTATGAAATCGAAACCACCCATCAAATTAATCTAAGAGATACGAGAGAAGGAACCTGAATTAATTCTTCGCAACCAGCCAGCCA[G/A]
CCAGGAATCACAAGGGCCAGGGAGATGCCTTGAAGGTGTTTTGTCGAATAGTTGTTGAGCGGTGTTGAACTGATCGCTCACGCTACCAATGGCGATGGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 22.00% 0.11% 0.00% NA
All Indica  2759 72.10% 27.80% 0.07% 0.00% NA
All Japonica  1512 88.70% 11.20% 0.13% 0.00% NA
Aus  269 72.90% 26.80% 0.37% 0.00% NA
Indica I  595 82.50% 17.50% 0.00% 0.00% NA
Indica II  465 69.00% 30.80% 0.22% 0.00% NA
Indica III  913 64.40% 35.50% 0.11% 0.00% NA
Indica Intermediate  786 74.90% 25.10% 0.00% 0.00% NA
Temperate Japonica  767 87.70% 12.00% 0.26% 0.00% NA
Tropical Japonica  504 87.10% 12.90% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401115443 C -> T LOC_Os04g02850.1 downstream_gene_variant ; 2147.0bp to feature; MODIFIER silent_mutation Average:73.24; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N
vg0401115443 C -> T LOC_Os04g02860.1 intron_variant ; MODIFIER silent_mutation Average:73.24; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401115443 C T -0.05 -0.05 -0.05 -0.03 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401115443 1.27E-06 NA mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401115443 1.26E-06 1.84E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401115443 3.69E-06 3.69E-06 mr1883 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251