| Variant ID: vg0400957232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 957232 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, G: 0.08, others allele: 0.00, population size: 94. )
CCCAGTTGGTAACACCAACCGGGACTAAAGATTAGAACTTTAGTCCCGGTTGATGTTACCAATCGGGACTAAAGATCAAGTTGATCTTTATACCCGATTG[T/G]
TAACACCAACCGGGACTAAAGTTAGCACGCCATATATGTTCTTCTTCCTTCTCCAGCCTGAGCATGGCTTCATTTTTTGAAGAGGAGGAGGGGAGGTGCT
AGCACCTCCCCTCCTCCTCTTCAAAAAATGAAGCCATGCTCAGGCTGGAGAAGGAAGAAGAACATATATGGCGTGCTAACTTTAGTCCCGGTTGGTGTTA[A/C]
CAATCGGGTATAAAGATCAACTTGATCTTTAGTCCCGATTGGTAACATCAACCGGGACTAAAGTTCTAATCTTTAGTCCCGGTTGGTGTTACCAACTGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 35.00% | 2.75% | 1.16% | NA |
| All Indica | 2759 | 47.90% | 47.00% | 3.15% | 1.92% | NA |
| All Japonica | 1512 | 92.90% | 4.40% | 2.65% | 0.07% | NA |
| Aus | 269 | 7.40% | 91.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 75.30% | 21.50% | 2.02% | 1.18% | NA |
| Indica II | 465 | 44.50% | 50.10% | 2.80% | 2.58% | NA |
| Indica III | 913 | 38.90% | 55.50% | 4.05% | 1.53% | NA |
| Indica Intermediate | 786 | 39.60% | 54.70% | 3.18% | 2.54% | NA |
| Temperate Japonica | 767 | 93.90% | 1.00% | 5.08% | 0.00% | NA |
| Tropical Japonica | 504 | 89.70% | 10.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400957232 | T -> DEL | N | N | silent_mutation | Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg0400957232 | T -> G | LOC_Os04g02560.1 | downstream_gene_variant ; 2232.0bp to feature; MODIFIER | silent_mutation | Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg0400957232 | T -> G | LOC_Os04g02550-LOC_Os04g02560 | intergenic_region ; MODIFIER | silent_mutation | Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400957232 | NA | 9.68E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | NA | 3.14E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | NA | 6.73E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | NA | 6.79E-06 | mr1298_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | 4.41E-08 | 4.41E-08 | mr1377_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | NA | 5.51E-09 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | NA | 5.30E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400957232 | NA | 4.16E-06 | mr1713_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |