Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400075143:

Variant ID: vg0400075143 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 75143
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGAAAATTAGACATGAGGACATACCAAAGACTGCTTTTGTGACAAGGTATGGATTATATGAGTTTACAGTAATGGCATTTGGATTAACCAACGCTCCT[G/A]
CTTACTTCATGAATCTTACATGCGTTGAAAATTTGGCGACACTACTTAATTGGGAATCATTGAAAGATCTATACCGATCATAAGAGTTTGAAATATATTT

Reverse complement sequence

AAATATATTTCAAACTCTTATGATCGGTATAGATCTTTCAATGATTCCCAATTAAGTAGTGTCGCCAAATTTTCAACGCATGTAAGATTCATGAAGTAAG[C/T]
AGGAGCGTTGGTTAATCCAAATGCCATTACTGTAAACTCATATAATCCATACCTTGTCACAAAAGCAGTCTTTGGTATGTCCTCATGTCTAATTTTCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 43.00% 5.52% 0.85% NA
All Indica  2759 23.60% 70.10% 6.16% 0.18% NA
All Japonica  1512 88.40% 4.10% 5.29% 2.25% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 18.70% 74.30% 6.72% 0.34% NA
Indica II  465 11.80% 80.90% 6.88% 0.43% NA
Indica III  913 25.80% 70.00% 4.16% 0.00% NA
Indica Intermediate  786 31.60% 60.70% 7.63% 0.13% NA
Temperate Japonica  767 98.80% 0.10% 0.91% 0.13% NA
Tropical Japonica  504 73.80% 11.30% 10.32% 4.56% NA
Japonica Intermediate  241 85.50% 1.70% 8.71% 4.15% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 53.30% 33.30% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400075143 G -> DEL N N silent_mutation Average:21.583; most accessible tissue: Zhenshan97 young leaf, score: 37.172 N N N N
vg0400075143 G -> A LOC_Os04g01100.1 upstream_gene_variant ; 4446.0bp to feature; MODIFIER silent_mutation Average:21.583; most accessible tissue: Zhenshan97 young leaf, score: 37.172 N N N N
vg0400075143 G -> A LOC_Os04g01110.1 upstream_gene_variant ; 2918.0bp to feature; MODIFIER silent_mutation Average:21.583; most accessible tissue: Zhenshan97 young leaf, score: 37.172 N N N N
vg0400075143 G -> A LOC_Os04g01120.1 intron_variant ; MODIFIER silent_mutation Average:21.583; most accessible tissue: Zhenshan97 young leaf, score: 37.172 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400075143 NA 1.50E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 4.95E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.05E-16 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.45E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 3.34E-06 1.37E-14 mr1299 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 3.75E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 6.61E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 8.64E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.82E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 8.65E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 3.02E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 2.60E-29 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 4.43E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 9.85E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 9.89E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 7.74E-06 NA mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 2.28E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.24E-12 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 3.03E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 6.32E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.04E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 9.63E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.27E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.47E-18 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.82E-10 mr1716 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 3.55E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 4.93E-07 5.79E-12 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 5.31E-06 5.31E-06 mr1756 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 6.22E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.25E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 9.40E-06 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.42E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 5.76E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 7.46E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.57E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 8.62E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 7.45E-06 2.96E-07 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 1.48E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 9.37E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400075143 NA 2.62E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251