Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400068159:

Variant ID: vg0400068159 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 68159
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.10, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGCTACACTTGGTCTATATCACCCGGAAGATTTATTACTTGGGAGCATGTTACATGCGCCATCCTTTAACGGATGTCGAAGGCATATTTTTTGGCCTA[A/G,T]
GCCTAATATGTCTGCAGCCCATATTTTAAGGTGTGGCCTGTCACATTCTTTTAGGGACTTAGGCACTTTTTGCTTAGGCCAAAGTGCGCGTGATTAAGTA

Reverse complement sequence

TACTTAATCACGCGCACTTTGGCCTAAGCAAAAAGTGCCTAAGTCCCTAAAAGAATGTGACAGGCCACACCTTAAAATATGGGCTGCAGACATATTAGGC[T/C,A]
TAGGCCAAAAAATATGCCTTCGACATCCGTTAAAGGATGGCGCATGTAACATGCTCCCAAGTAATAAATCTTCCGGGTGATATAGACCAAGTGTAGCTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.00%	18.90%	0.06%	0.00%	T: 0.04%
All Indica	2759	98.60%	1.40%	0.07%	0.00%	NA
All Japonica	1512	44.80%	55.10%	0.07%	0.00%	NA
Aus	269	98.90%	0.40%	0.00%	0.00%	T: 0.74%
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	12.50%	87.40%	0.13%	0.00%	NA
Tropical Japonica	504	84.10%	15.90%	0.00%	0.00%	NA
Japonica Intermediate	241	65.60%	34.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400068159	A -> G	LOC_Os04g01080.1	downstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> G	LOC_Os04g01100.1	downstream_gene_variant ; 1576.0bp to feature; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> G	LOC_Os04g01110.1	downstream_gene_variant ; 3096.0bp to feature; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> G	LOC_Os04g01080-LOC_Os04g01100	intergenic_region ; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> T	LOC_Os04g01080.1	downstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> T	LOC_Os04g01100.1	downstream_gene_variant ; 1576.0bp to feature; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> T	LOC_Os04g01110.1	downstream_gene_variant ; 3096.0bp to feature; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0400068159	A -> T	LOC_Os04g01080-LOC_Os04g01100	intergenic_region ; MODIFIER	silent_mutation	Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400068159	NA	2.40E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	1.08E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	7.07E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	9.37E-06	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	5.75E-06	3.98E-19	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	4.11E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	3.08E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	8.77E-12	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	5.10E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	8.99E-17	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	7.08E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	1.68E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	3.19E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	4.77E-08	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	4.01E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	1.57E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	6.81E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	1.95E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	2.47E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	2.10E-06	3.12E-10	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	7.97E-08	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	7.29E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	5.51E-09	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	1.68E-07	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	2.52E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	4.71E-10	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	4.50E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	3.16E-06	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	5.22E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	6.69E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	2.19E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	6.19E-17	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	2.76E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	5.43E-28	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	3.22E-06	NA	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	1.57E-09	mr1780_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	3.39E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	3.07E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159	NA	6.56E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251