| Variant ID: vg0400066292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 66292 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )
CGTATGGTTTATACCGCTACCACTACTGATGGACATCATCGTCTTCCGTCACCGACTGGTTATGCCGCCGCCGACTGGAGTATCTATCTTCACAACTACA[C/T]
GTCTTCGCCACCGGTTTTCTTCTGTTGCCGCTGACTCGTGTTCACTTCATCGTTTTCTTCTGTTGCCGCTGCCTCGTGTTCACTTCATCACAGCTTTGCA
TGCAAAGCTGTGATGAAGTGAACACGAGGCAGCGGCAACAGAAGAAAACGATGAAGTGAACACGAGTCAGCGGCAACAGAAGAAAACCGGTGGCGAAGAC[G/A]
TGTAGTTGTGAAGATAGATACTCCAGTCGGCGGCGGCATAACCAGTCGGTGACGGAAGACGATGATGTCCATCAGTAGTGGTAGCGGTATAAACCATACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 6.90% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 92.20% | 7.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 91.90% | 7.40% | 0.73% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 12.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.70% | 13.80% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400066292 | C -> T | LOC_Os04g01070.1 | downstream_gene_variant ; 4467.0bp to feature; MODIFIER | silent_mutation | Average:39.833; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0400066292 | C -> T | LOC_Os04g01080.1 | downstream_gene_variant ; 1624.0bp to feature; MODIFIER | silent_mutation | Average:39.833; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0400066292 | C -> T | LOC_Os04g01100.1 | downstream_gene_variant ; 3443.0bp to feature; MODIFIER | silent_mutation | Average:39.833; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0400066292 | C -> T | LOC_Os04g01110.1 | downstream_gene_variant ; 4963.0bp to feature; MODIFIER | silent_mutation | Average:39.833; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0400066292 | C -> T | LOC_Os04g01080-LOC_Os04g01100 | intergenic_region ; MODIFIER | silent_mutation | Average:39.833; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400066292 | NA | 1.58E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | NA | 5.03E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 8.84E-06 | 8.68E-07 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | NA | 6.19E-07 | mr1976 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 2.32E-08 | 1.57E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 8.18E-06 | NA | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 1.61E-07 | 2.25E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 3.02E-06 | NA | mr1670_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 3.57E-08 | 3.58E-08 | mr1670_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 1.59E-07 | NA | mr1672_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 3.85E-07 | 3.02E-07 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400066292 | 6.52E-06 | 1.01E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |