Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0336337217:

Variant ID: vg0336337217 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 36337217
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAACACATTTACACACACACTAGGGTCATTTAACTCTCCCTTTTATAGCGGCCCTTCTTGTGTGAAAAGAAAGAATAACATAAATGTAATAAAAAAAA[T/A]
ATATATCTCATTCCAATTCTAGCCACCACAATTTAGCTCAACCATCACTAAGTGGTCTGCCTCCTATTATATTGCCATCATCAAGCCTATTAATTAACAC

Reverse complement sequence

GTGTTAATTAATAGGCTTGATGATGGCAATATAATAGGAGGCAGACCACTTAGTGATGGTTGAGCTAAATTGTGGTGGCTAGAATTGGAATGAGATATAT[A/T]
TTTTTTTTATTACATTTATGTTATTCTTTCTTTTCACACAAGAAGGGCCGCTATAAAAGGGAGAGTTAAATGACCCTAGTGTGTGTGTAAATGTGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	6.20%	1.10%	0.00%	NA
All Indica	2759	88.20%	10.10%	1.70%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.30%	3.20%	2.52%	0.00%	NA
Indica II	465	87.70%	10.80%	1.51%	0.00%	NA
Indica III	913	86.50%	13.40%	0.11%	0.00%	NA
Indica Intermediate	786	85.90%	11.10%	3.05%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0336337217	T -> A	LOC_Os03g64290.1	upstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336337217	T -> A	LOC_Os03g64300.1	upstream_gene_variant ; 2866.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336337217	T -> A	LOC_Os03g64290-LOC_Os03g64300	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0336337217	NA	8.14E-09	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	3.79E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	4.46E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	7.24E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	4.80E-12	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	3.44E-07	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	3.07E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	3.84E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	2.68E-06	6.26E-08	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	8.74E-07	NA	mr1233_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	6.79E-07	5.87E-10	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	7.83E-07	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	9.60E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217	NA	1.01E-07	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251