| Variant ID: vg0336243482 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36243482 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAGTAGGTATCATTATACTCTACATTATCAATTTTTTTTAGAATTTTTCA[C/T]
AACTATTTGCATCGAATTTGGAAGAAAAAGATATACGAGGGGATATCCCTCGAGGGATTAGAATCCACACTCCAGTACAGACTCGAGGGGTTGGCTTCCT
AGGAAGCCAACCCCTCGAGTCTGTACTGGAGTGTGGATTCTAATCCCTCGAGGGATATCCCCTCGTATATCTTTTTCTTCCAAATTCGATGCAAATAGTT[G/A]
TGAAAAATTCTAAAAAAAATTGATAATGTAGAGTATAATGATACCTACTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAACAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 3.90% | 1.29% | 0.63% | NA |
| All Indica | 2759 | 90.20% | 6.60% | 2.17% | 1.05% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 2.00% | 1.18% | 0.17% | NA |
| Indica II | 465 | 94.20% | 3.70% | 1.51% | 0.65% | NA |
| Indica III | 913 | 82.40% | 12.70% | 2.85% | 2.08% | NA |
| Indica Intermediate | 786 | 92.00% | 4.70% | 2.54% | 0.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336243482 | C -> T | LOC_Os03g64140.1 | 3_prime_UTR_variant ; 112.0bp to feature; MODIFIER | silent_mutation | Average:60.983; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg0336243482 | C -> T | LOC_Os03g64130.1 | upstream_gene_variant ; 2669.0bp to feature; MODIFIER | silent_mutation | Average:60.983; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg0336243482 | C -> T | LOC_Os03g64150.1 | downstream_gene_variant ; 2604.0bp to feature; MODIFIER | silent_mutation | Average:60.983; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg0336243482 | C -> DEL | N | N | silent_mutation | Average:60.983; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336243482 | NA | 2.74E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243482 | 2.04E-06 | 2.04E-06 | mr1487 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243482 | NA | 1.58E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243482 | NA | 1.50E-06 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |