| Variant ID: vg0336037583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36037583 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTTATTTTTAATTCCGAATTTCAGTTATTTTCTAATTGTATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTTCGAATTTT[A/T]
ACTATTTCTAAATTGTATTTCTATATTGACTCTAGTCTCCTCTTCTAATATTTCTTATTTTTTAATTCTGAATTTCAGCTATTTCTAAATTGTATTTCTA
TAGAAATACAATTTAGAAATAGCTGAAATTCAGAATTAAAAAATAAGAAATATTAGAAGAGGAGACTAGAGTCAATATAGAAATACAATTTAGAAATAGT[T/A]
AAAATTCGAAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATACAATTAGAAAATAACTGAAATTCGGAATTAAAAATAAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 0.80% | 0.95% | 19.83% | NA |
| All Indica | 2759 | 65.50% | 0.00% | 1.27% | 33.24% | NA |
| All Japonica | 1512 | 96.80% | 2.30% | 0.66% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.30% | 0.00% | 0.84% | 45.88% | NA |
| Indica II | 465 | 80.90% | 0.00% | 1.72% | 17.42% | NA |
| Indica III | 913 | 62.20% | 0.00% | 1.42% | 36.36% | NA |
| Indica Intermediate | 786 | 69.50% | 0.00% | 1.15% | 29.39% | NA |
| Temperate Japonica | 767 | 97.10% | 1.70% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 3.20% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 0.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336037583 | A -> T | LOC_Os03g63810.1 | upstream_gene_variant ; 1581.0bp to feature; MODIFIER | silent_mutation | Average:11.134; most accessible tissue: Zhenshan97 flower, score: 23.247 | N | N | N | N |
| vg0336037583 | A -> T | LOC_Os03g63800-LOC_Os03g63810 | intergenic_region ; MODIFIER | silent_mutation | Average:11.134; most accessible tissue: Zhenshan97 flower, score: 23.247 | N | N | N | N |
| vg0336037583 | A -> DEL | N | N | silent_mutation | Average:11.134; most accessible tissue: Zhenshan97 flower, score: 23.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336037583 | 8.37E-07 | 8.37E-07 | mr1924 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336037583 | 8.76E-07 | 8.76E-07 | mr1004_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |