Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335763672:

Variant ID: vg0335763672 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35763672
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAGACTAAGCTTAAGTGTCAGGATCGGGTTAGGAGCTAGCACGGAGAAATTAATCAACCCTAATTCAAATGCCATATACTGGTAGAGAAACCATCTTT[A/G]
GTCGGTCGACCCATATCCACAATAGTCCCGGTTCCATTAAAAACCGGGACTAAAAATGATTTTTAGTCCCGGTTAATAAGAGGAAGATCTTTAGTCCCGG

Reverse complement sequence

CCGGGACTAAAGATCTTCCTCTTATTAACCGGGACTAAAAATCATTTTTAGTCCCGGTTTTTAATGGAACCGGGACTATTGTGGATATGGGTCGACCGAC[T/C]
AAAGATGGTTTCTCTACCAGTATATGGCATTTGAATTAGGGTTGATTAATTTCTCCGTGCTAGCTCCTAACCCGATCCTGACACTTAAGCTTAGTCTAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	17.40%	1.23%	43.69%	NA
All Indica	2759	35.00%	1.10%	1.56%	62.34%	NA
All Japonica	1512	45.00%	51.30%	0.07%	3.64%	NA
Aus	269	0.40%	0.00%	4.09%	95.54%	NA
Indica I	595	20.80%	0.80%	1.34%	76.97%	NA
Indica II	465	55.50%	3.00%	1.08%	40.43%	NA
Indica III	913	39.00%	0.50%	0.88%	59.58%	NA
Indica Intermediate	786	28.90%	0.90%	2.80%	67.43%	NA
Temperate Japonica	767	9.90%	86.00%	0.13%	3.91%	NA
Tropical Japonica	504	89.50%	6.00%	0.00%	4.56%	NA
Japonica Intermediate	241	63.50%	35.70%	0.00%	0.83%	NA
VI/Aromatic	96	93.80%	3.10%	1.04%	2.08%	NA
Intermediate	90	48.90%	14.40%	2.22%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335763672	A -> DEL	N	N	silent_mutation	Average:40.127; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N
vg0335763672	A -> G	LOC_Os03g63280.1	upstream_gene_variant ; 3258.0bp to feature; MODIFIER	silent_mutation	Average:40.127; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N
vg0335763672	A -> G	LOC_Os03g63270-LOC_Os03g63280	intergenic_region ; MODIFIER	silent_mutation	Average:40.127; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335763672	NA	1.75E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	1.18E-06	1.78E-09	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	7.17E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	3.20E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	4.24E-06	mr1947	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	1.94E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	7.31E-09	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	8.10E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	6.70E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672	NA	6.91E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251