Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335609936:

Variant ID: vg0335609936 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35609936
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TATCCGATGTCACCTCAAAAATATTCTCTCCCAACGGCCACATTTTGGGGATCTATAAATACCCCCCACCTAACCCTTTTCTAGGGTTACCCAACTCATT[C/A]
ATTTACATTCACTTTGGGTTGAGCTTGGTGCTAAGGTGCTTTGAATCTTTGAGCTCTTTCTCCCTCAATCAAATCCCTCCTCATTCTTTGTGTGGTGGAT

Reverse complement sequence

ATCCACCACACAAAGAATGAGGAGGGATTTGATTGAGGGAGAAAGAGCTCAAAGATTCAAAGCACCTTAGCACCAAGCTCAACCCAAAGTGAATGTAAAT[G/T]
AATGAGTTGGGTAACCCTAGAAAAGGGTTAGGTGGGGGGTATTTATAGATCCCCAAAATGTGGCCGTTGGGAGAGAATATTTTTGAGGTGACATCGGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.20%	0.06%	0.00%	NA
All Indica	2759	55.60%	44.30%	0.11%	0.00%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	43.90%	56.10%	0.00%	0.00%	NA
Indica I	595	87.70%	12.30%	0.00%	0.00%	NA
Indica II	465	72.00%	27.70%	0.22%	0.00%	NA
Indica III	913	20.90%	79.10%	0.00%	0.00%	NA
Indica Intermediate	786	61.70%	38.00%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335609936	C -> A	LOC_Os03g62950.1	upstream_gene_variant ; 2070.0bp to feature; MODIFIER	silent_mutation	Average:37.701; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0335609936	C -> A	LOC_Os03g62950-LOC_Os03g62974	intergenic_region ; MODIFIER	silent_mutation	Average:37.701; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335609936	NA	1.67E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0335609936	1.48E-06	NA	mr1165_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	NA	9.52E-06	mr1216_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	NA	3.88E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	NA	3.63E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	8.80E-06	3.96E-07	mr1471_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	5.79E-06	NA	mr1477_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	NA	2.47E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936	NA	2.80E-07	mr1879_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251