Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335543608:

Variant ID: vg0335543608 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35543608
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAACATATGTAGGTAATAACATGCTTATTATCTTCTTCATCCTTTTATTTTTTGAGTTCCAAAATCAAAGTGAAATTTACGACTTATCTTCTTCCTCTT[C/T]
CCTTTTTTTTTTTTTGAGTTTTGAGTTCCAAAATCCGACTAAGTAATTTTTCTCCACCTCTTCTATCGTATTTTTTTATCTCCCTCTGTTTTTATGTTTG

Reverse complement sequence

CAAACATAAAAACAGAGGGAGATAAAAAAATACGATAGAAGAGGTGGAGAAAAATTACTTAGTCGGATTTTGGAACTCAAAACTCAAAAAAAAAAAAAGG[G/A]
AAGAGGAAGAAGATAAGTCGTAAATTTCACTTTGATTTTGGAACTCAAAAAATAAAAGGATGAAGAAGATAATAAGCATGTTATTACCTACATATGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	31.20%	0.15%	0.00%	NA
All Indica	2759	75.80%	24.10%	0.11%	0.00%	NA
All Japonica	1512	54.40%	45.50%	0.13%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	65.50%	34.10%	0.34%	0.00%	NA
Indica II	465	48.20%	51.80%	0.00%	0.00%	NA
Indica III	913	94.60%	5.40%	0.00%	0.00%	NA
Indica Intermediate	786	78.10%	21.80%	0.13%	0.00%	NA
Temperate Japonica	767	89.60%	10.40%	0.00%	0.00%	NA
Tropical Japonica	504	9.70%	90.10%	0.20%	0.00%	NA
Japonica Intermediate	241	35.70%	63.90%	0.41%	0.00%	NA
VI/Aromatic	96	12.50%	86.50%	1.04%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335543608	C -> T	LOC_Os03g62840.1	upstream_gene_variant ; 4073.0bp to feature; MODIFIER	silent_mutation	Average:52.128; most accessible tissue: Callus, score: 64.108	N	N	N	N
vg0335543608	C -> T	LOC_Os03g62820.1	downstream_gene_variant ; 3461.0bp to feature; MODIFIER	silent_mutation	Average:52.128; most accessible tissue: Callus, score: 64.108	N	N	N	N
vg0335543608	C -> T	LOC_Os03g62830.1	downstream_gene_variant ; 128.0bp to feature; MODIFIER	silent_mutation	Average:52.128; most accessible tissue: Callus, score: 64.108	N	N	N	N
vg0335543608	C -> T	LOC_Os03g62820-LOC_Os03g62830	intergenic_region ; MODIFIER	silent_mutation	Average:52.128; most accessible tissue: Callus, score: 64.108	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335543608	NA	2.75E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	3.93E-07	NA	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	1.59E-06	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	9.60E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	1.78E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	2.78E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	6.47E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	1.68E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	4.22E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608	NA	8.19E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251