Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335435424:

Variant ID: vg0335435424 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35435424
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGCCGAAGAGCAAACGCTGGTGTTATTGTGTGAATCAAAATGATCAAAATACAGTGGCGGAGCCAGAATTTTTCCAAACCTAGGGCCCAATTAGTTGA[G/A]
TGTATATGATTTTGCCTTTATCTTCTAGTTTTTGAAGTTTTAAAATGGAATTTCAATGAATATTTAGAATCAGGAGTAGGGAGTAGGGCTGCAGCCCTAG

Reverse complement sequence

CTAGGGCTGCAGCCCTACTCCCTACTCCTGATTCTAAATATTCATTGAAATTCCATTTTAAAACTTCAAAAACTAGAAGATAAAGGCAAAATCATATACA[C/T]
TCAACTAATTGGGCCCTAGGTTTGGAAAAATTCTGGCTCCGCCACTGTATTTTGATCATTTTGATTCACACAATAACACCAGCGTTTGCTCTTCGGCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	4.30%	0.36%	35.51%	NA
All Indica	2759	43.10%	2.80%	0.51%	53.64%	NA
All Japonica	1512	98.40%	0.10%	0.07%	1.39%	NA
Aus	269	1.50%	44.20%	0.74%	53.53%	NA
Indica I	595	83.40%	0.00%	0.00%	16.64%	NA
Indica II	465	64.90%	7.10%	0.00%	27.96%	NA
Indica III	913	8.20%	0.80%	0.99%	90.03%	NA
Indica Intermediate	786	40.20%	4.60%	0.64%	54.58%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	95.80%	0.20%	0.20%	3.77%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	61.10%	7.80%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335435424	G -> A	LOC_Os03g62590.1	upstream_gene_variant ; 4937.0bp to feature; MODIFIER	silent_mutation	Average:61.568; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N
vg0335435424	G -> A	LOC_Os03g62600.1	upstream_gene_variant ; 834.0bp to feature; MODIFIER	silent_mutation	Average:61.568; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N
vg0335435424	G -> A	LOC_Os03g62610.1	upstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:61.568; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N
vg0335435424	G -> A	LOC_Os03g62600-LOC_Os03g62610	intergenic_region ; MODIFIER	silent_mutation	Average:61.568; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N
vg0335435424	G -> DEL	N	N	silent_mutation	Average:61.568; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0335435424	G	A	-0.01	-0.02	-0.02	-0.03	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335435424	8.43E-06	NA	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335435424	5.13E-08	NA	mr1151_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335435424	5.89E-06	NA	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251