Variant ID: vg0335384067 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 35384067 |
Reference Allele: G | Alternative Allele: C,A |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, C: 0.24, others allele: 0.00, population size: 173. )
TGAGTGTTTCATGAATGATTGAAGGCAAAACTCTCTCATTGAAATTCTCCCCCAGGGACCTGTAGATGGTTGGTAGCTTCTCTGGTAACGGTCTTGTAAG[G/C,A]
ACACGAAGACCAATTCTCACCTGTCCAAGTTATCAAATTGTATCAAACTAAAAATGTGTTGGTACTGACCTCTACCAATGTTACTTTGAAGCAAAGGTCT
AGACCTTTGCTTCAAAGTAACATTGGTAGAGGTCAGTACCAACACATTTTTAGTTTGATACAATTTGATAACTTGGACAGGTGAGAATTGGTCTTCGTGT[C/G,T]
CTTACAAGACCGTTACCAGAGAAGCTACCAACCATCTACAGGTCCCTGGGGGAGAATTTCAATGAGAGAGTTTTGCCTTCAATCATTCATGAAACACTCA
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 76.90% | 23.00% | 0.11% | 0.00% | NA |
All Indica | 2759 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 47.40% | 52.30% | 0.33% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 11.20% | 88.10% | 0.65% | 0.00% | NA |
Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0335384067 | G -> C | LOC_Os03g62490.1 | synonymous_variant ; p.Val105Val; LOW | synonymous_codon | Average:47.873; most accessible tissue: Callus, score: 59.804 | N | N | N | N |
vg0335384067 | G -> A | LOC_Os03g62490.1 | synonymous_variant ; p.Val105Val; LOW | N | Average:47.873; most accessible tissue: Callus, score: 59.804 | N | N | N | N |
vg0335384067 | G -> A | LOC_Os03g62480.1 | upstream_gene_variant ; 2086.0bp to feature; MODIFIER | N | Average:47.873; most accessible tissue: Callus, score: 59.804 | N | N | N | N |
vg0335384067 | G -> A | LOC_Os03g62500.1 | downstream_gene_variant ; 1715.0bp to feature; MODIFIER | N | Average:47.873; most accessible tissue: Callus, score: 59.804 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0335384067 | 5.15E-06 | NA | Awn_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0335384067 | NA | 5.74E-25 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | 4.15E-06 | 4.39E-07 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | 1.16E-06 | 1.69E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | 3.48E-07 | NA | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | NA | 5.38E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | NA | 7.66E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | NA | 1.70E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | NA | 5.15E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335384067 | NA | 7.92E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/