Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335364463:

Variant ID: vg0335364463 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35364463
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTGGAGACAAATTTCCTTTCTTTTTGGTTGAACATATTGTAGTCCACCAGAACGAAACACATCATCATGTACAACTAAAGTTATGTTTGACTTCTGTT[G/A]
CAGTATGAGACAAGAGTTAGTCTCTGTGTGAGCAGGTAGAAGATCTGTTTGAATCTAATGCCCAATTGTGACAACGACTACCAAATCCAACTCTGGTCAA

Reverse complement sequence

TTGACCAGAGTTGGATTTGGTAGTCGTTGTCACAATTGGGCATTAGATTCAAACAGATCTTCTACCTGCTCACACAGAGACTAACTCTTGTCTCATACTG[C/T]
AACAGAAGTCAAACATAACTTTAGTTGTACATGATGATGTGTTTCGTTCTGGTGGACTACAATATGTTCAACCAAAAAGAAAGGAAATTTGTCTCCACCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	23.10%	0.08%	0.08%	NA
All Indica	2759	90.00%	9.70%	0.11%	0.14%	NA
All Japonica	1512	47.00%	53.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	86.90%	12.70%	0.22%	0.22%	NA
Indica III	913	86.50%	13.00%	0.22%	0.22%	NA
Indica Intermediate	786	88.80%	11.10%	0.00%	0.13%	NA
Temperate Japonica	767	10.60%	89.40%	0.00%	0.00%	NA
Tropical Japonica	504	93.10%	6.70%	0.20%	0.00%	NA
Japonica Intermediate	241	66.40%	33.60%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335364463	G -> A	LOC_Os03g62430.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:70.734; most accessible tissue: Callus, score: 91.675	N	N	N	N
vg0335364463	G -> A	LOC_Os03g62450.1	upstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:70.734; most accessible tissue: Callus, score: 91.675	N	N	N	N
vg0335364463	G -> A	LOC_Os03g62440.1	downstream_gene_variant ; 1332.0bp to feature; MODIFIER	silent_mutation	Average:70.734; most accessible tissue: Callus, score: 91.675	N	N	N	N
vg0335364463	G -> DEL	N	N	silent_mutation	Average:70.734; most accessible tissue: Callus, score: 91.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335364463	NA	1.66E-24	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	5.67E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	1.54E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	2.06E-06	NA	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	2.58E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	5.42E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	1.56E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	5.38E-07	1.82E-07	mr1233_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	3.05E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	3.92E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	1.05E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	2.96E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335364463	NA	1.88E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251