Variant ID: vg0335186694 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 35186694 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 113. )
CCCACCGTTCCATATCGCAAGTTATTTTAGTTTTAGTCAAAGTTTAATTTTAACTTTTTATCAAGTTTACAGAAAATTAAAGATATACCAATATTTTTAA[T/C]
AACATATAAACAAACTATCACGATATATATTTTCTGGATTTTACGAAACTAATTTTATGTCACAGTGGTTGGTGTATTTTTTTTATATAAATCTAGCCAA
TTGGCTAGATTTATATAAAAAAAATACACCAACCACTGTGACATAAAATTAGTTTCGTAAAATCCAGAAAATATATATCGTGATAGTTTGTTTATATGTT[A/G]
TTAAAAATATTGGTATATCTTTAATTTTCTGTAAACTTGATAAAAAGTTAAAATTAAACTTTGACTAAAACTAAAATAACTTGCGATATGGAACGGTGGG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 77.40% | 22.40% | 0.15% | 0.00% | NA |
All Indica | 2759 | 64.30% | 35.50% | 0.25% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 81.20% | 18.50% | 0.34% | 0.00% | NA |
Indica II | 465 | 38.70% | 61.10% | 0.22% | 0.00% | NA |
Indica III | 913 | 74.20% | 25.40% | 0.44% | 0.00% | NA |
Indica Intermediate | 786 | 55.10% | 44.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0335186694 | T -> C | LOC_Os03g62110.2 | upstream_gene_variant ; 4101.0bp to feature; MODIFIER | silent_mutation | Average:49.767; most accessible tissue: Callus, score: 80.14 | N | N | N | N |
vg0335186694 | T -> C | LOC_Os03g62110.3 | upstream_gene_variant ; 4101.0bp to feature; MODIFIER | silent_mutation | Average:49.767; most accessible tissue: Callus, score: 80.14 | N | N | N | N |
vg0335186694 | T -> C | LOC_Os03g62090.1 | downstream_gene_variant ; 3271.0bp to feature; MODIFIER | silent_mutation | Average:49.767; most accessible tissue: Callus, score: 80.14 | N | N | N | N |
vg0335186694 | T -> C | LOC_Os03g62100.1 | downstream_gene_variant ; 2729.0bp to feature; MODIFIER | silent_mutation | Average:49.767; most accessible tissue: Callus, score: 80.14 | N | N | N | N |
vg0335186694 | T -> C | LOC_Os03g62090-LOC_Os03g62100 | intergenic_region ; MODIFIER | silent_mutation | Average:49.767; most accessible tissue: Callus, score: 80.14 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0335186694 | NA | 7.79E-06 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 4.80E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 9.62E-08 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 1.03E-06 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | 2.40E-06 | NA | mr1151_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 1.57E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 8.38E-12 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 9.39E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335186694 | NA | 1.05E-06 | mr1910_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |