Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335186694:

Variant ID: vg0335186694 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35186694
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CCCACCGTTCCATATCGCAAGTTATTTTAGTTTTAGTCAAAGTTTAATTTTAACTTTTTATCAAGTTTACAGAAAATTAAAGATATACCAATATTTTTAA[T/C]
AACATATAAACAAACTATCACGATATATATTTTCTGGATTTTACGAAACTAATTTTATGTCACAGTGGTTGGTGTATTTTTTTTATATAAATCTAGCCAA

Reverse complement sequence

TTGGCTAGATTTATATAAAAAAAATACACCAACCACTGTGACATAAAATTAGTTTCGTAAAATCCAGAAAATATATATCGTGATAGTTTGTTTATATGTT[A/G]
TTAAAAATATTGGTATATCTTTAATTTTCTGTAAACTTGATAAAAAGTTAAAATTAAACTTTGACTAAAACTAAAATAACTTGCGATATGGAACGGTGGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	22.40%	0.15%	0.00%	NA
All Indica	2759	64.30%	35.50%	0.25%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	82.20%	17.80%	0.00%	0.00%	NA
Indica I	595	81.20%	18.50%	0.34%	0.00%	NA
Indica II	465	38.70%	61.10%	0.22%	0.00%	NA
Indica III	913	74.20%	25.40%	0.44%	0.00%	NA
Indica Intermediate	786	55.10%	44.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335186694	T -> C	LOC_Os03g62110.2	upstream_gene_variant ; 4101.0bp to feature; MODIFIER	silent_mutation	Average:49.767; most accessible tissue: Callus, score: 80.14	N	N	N	N
vg0335186694	T -> C	LOC_Os03g62110.3	upstream_gene_variant ; 4101.0bp to feature; MODIFIER	silent_mutation	Average:49.767; most accessible tissue: Callus, score: 80.14	N	N	N	N
vg0335186694	T -> C	LOC_Os03g62090.1	downstream_gene_variant ; 3271.0bp to feature; MODIFIER	silent_mutation	Average:49.767; most accessible tissue: Callus, score: 80.14	N	N	N	N
vg0335186694	T -> C	LOC_Os03g62100.1	downstream_gene_variant ; 2729.0bp to feature; MODIFIER	silent_mutation	Average:49.767; most accessible tissue: Callus, score: 80.14	N	N	N	N
vg0335186694	T -> C	LOC_Os03g62090-LOC_Os03g62100	intergenic_region ; MODIFIER	silent_mutation	Average:49.767; most accessible tissue: Callus, score: 80.14	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335186694	NA	7.79E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	4.80E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	9.62E-08	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	1.03E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	2.40E-06	NA	mr1151_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	1.57E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	8.38E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	9.39E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694	NA	1.05E-06	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251