Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335145372:

Variant ID: vg0335145372 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35145372
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAAACCCAGCAGGACAATAAACTCTATAAGTTTTTAGATCCAATTTTTAAAGGTTCCAAGGAGAATGAACAAAGCTAATAAAAAATAATATGACAGAA[G/C]
TAAGGGGTAGCAACTGATGTGTCTTTTAAAAACTATAAAATTAGAAATATGAGGATGATAAGGTTTGATCTTTCAAAATCTTAAGACAACGAGATAACTA

Reverse complement sequence

TAGTTATCTCGTTGTCTTAAGATTTTGAAAGATCAAACCTTATCATCCTCATATTTCTAATTTTATAGTTTTTAAAAGACACATCAGTTGCTACCCCTTA[C/G]
TTCTGTCATATTATTTTTTATTAGCTTTGTTCATTCTCCTTGGAACCTTTAAAAATTGGATCTAAAAACTTATAGAGTTTATTGTCCTGCTGGGTTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	10.20%	4.70%	0.00%	NA
All Indica	2759	75.40%	16.90%	7.72%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.90%	11.60%	4.54%	0.00%	NA
Indica II	465	51.00%	32.30%	16.77%	0.00%	NA
Indica III	913	85.90%	10.80%	3.29%	0.00%	NA
Indica Intermediate	786	71.10%	19.00%	9.92%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	11.10%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335145372	G -> C	LOC_Os03g62020.1	upstream_gene_variant ; 262.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62040.1	upstream_gene_variant ; 4966.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62010.1	downstream_gene_variant ; 4156.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62030.1	downstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62030.3	downstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62030.4	downstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62030.2	downstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62030.5	downstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62030.6	downstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0335145372	G -> C	LOC_Os03g62010-LOC_Os03g62020	intergenic_region ; MODIFIER	silent_mutation	Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335145372	NA	7.56E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335145372	NA	7.47E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335145372	NA	5.23E-07	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335145372	NA	2.30E-06	mr1428_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251