Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334859631:

Variant ID: vg0334859631 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34859631
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATTTTTGATTTTTTATTATTTCTAATTATATTTATATGTGGACTCTAAACTCATCTCTCAATATTCTTTAATTTTGAATTTCAGTTACTTCTAAATT[A/G]
TATTCCTATATTGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATTGTATTTTTATACAGACTCAAAACTCTACT

Reverse complement sequence

AGTAGAGTTTTGAGTCTGTATAAAAATACAATTTACAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCAATATAGGAATA[T/C]
AATTTAGAAGTAACTGAAATTCAAAATTAAAGAATATTGAGAGATGAGTTTAGAGTCCACATATAAATATAATTAGAAATAATAAAAAATCAAAAATAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.00%	48.30%	2.12%	0.66%	NA
All Indica	2759	80.20%	15.50%	3.23%	1.05%	NA
All Japonica	1512	0.90%	98.90%	0.13%	0.00%	NA
Aus	269	19.00%	78.40%	2.23%	0.37%	NA
Indica I	595	89.20%	4.50%	5.88%	0.34%	NA
Indica II	465	75.70%	15.50%	5.16%	3.66%	NA
Indica III	913	81.10%	17.40%	1.20%	0.33%	NA
Indica Intermediate	786	74.90%	21.80%	2.42%	0.89%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.20%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	99.20%	0.41%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	35.60%	60.00%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334859631	A -> DEL	N	N	silent_mutation	Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0334859631	A -> G	LOC_Os03g61430.1	upstream_gene_variant ; 1747.0bp to feature; MODIFIER	silent_mutation	Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0334859631	A -> G	LOC_Os03g61450.1	upstream_gene_variant ; 4642.0bp to feature; MODIFIER	silent_mutation	Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0334859631	A -> G	LOC_Os03g61440.1	downstream_gene_variant ; 1129.0bp to feature; MODIFIER	silent_mutation	Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0334859631	A -> G	LOC_Os03g61430-LOC_Os03g61440	intergenic_region ; MODIFIER	silent_mutation	Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334859631	NA	6.05E-06	mr1053_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631	NA	2.08E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631	NA	9.65E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631	NA	3.07E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631	NA	2.51E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251