Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334788563:

Variant ID: vg0334788563 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34788563
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCTTTTTTTTTCTAAATCTAAAAAAAAAGGTTATGTTGTTTCTCGAGAAAAATGTTATGTTATTACATTGCCTGTTTTTCCCAATACATGGAAAAAAT[T/G]
TAGTAAATTCAAGTACTAGTGTTGCAAAATCCAATATTTTGGGTGGATTTAGTAATTTGTGGAGGGCGAGGTGTATGGTTCTTTCATGAGGCATTCTCTC

Reverse complement sequence

GAGAGAATGCCTCATGAAAGAACCATACACCTCGCCCTCCACAAATTACTAAATCCACCCAAAATATTGGATTTTGCAACACTAGTACTTGAATTTACTA[A/C]
ATTTTTTCCATGTATTGGGAAAAACAGGCAATGTAATAACATAACATTTTTCTCGAGAAACAACATAACCTTTTTTTTTAGATTTAGAAAAAAAAAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	4.40%	0.57%	8.38%	NA
All Indica	2759	78.00%	7.10%	0.91%	14.06%	NA
All Japonica	1512	99.70%	0.00%	0.00%	0.26%	NA
Aus	269	96.70%	2.60%	0.74%	0.00%	NA
Indica I	595	97.10%	1.30%	0.17%	1.34%	NA
Indica II	465	82.80%	12.00%	0.00%	5.16%	NA
Indica III	913	62.00%	7.80%	1.20%	29.03%	NA
Indica Intermediate	786	79.10%	7.60%	1.65%	11.58%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	8.90%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334788563	T -> DEL	N	N	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0334788563	T -> G	LOC_Os03g61270.1	upstream_gene_variant ; 3462.0bp to feature; MODIFIER	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0334788563	T -> G	LOC_Os03g61249.1	downstream_gene_variant ; 3719.0bp to feature; MODIFIER	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0334788563	T -> G	LOC_Os03g61260.1	downstream_gene_variant ; 1049.0bp to feature; MODIFIER	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0334788563	T -> G	LOC_Os03g61260.3	downstream_gene_variant ; 1049.0bp to feature; MODIFIER	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0334788563	T -> G	LOC_Os03g61260.4	downstream_gene_variant ; 1049.0bp to feature; MODIFIER	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0334788563	T -> G	LOC_Os03g61260-LOC_Os03g61270	intergenic_region ; MODIFIER	silent_mutation	Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334788563	1.93E-06	5.82E-08	mr1210	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334788563	NA	2.98E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334788563	NA	4.38E-06	mr1765	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334788563	NA	2.05E-06	mr1305_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251