| Variant ID: vg0334732696 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 34732696 |
| Reference Allele: GT | Alternative Allele: AT,G |
| Primary Allele: GT | Secondary Allele: AT |
Inferred Ancestral Allele: Not determined.
GTAAATTAATGTGGTTTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTCAAACATAAAAAGTAAAATGGTATGACTTTATGGAAAAAGAAAA[GT/AT,G]
AGGGAGATAGTTTGGACTGTAGATTAATCATTTAAAGGCTAAAAACAATTGTGTGATATGACTTAATTAGAGGAAAAAAAGAGAAAGATAATTTGGACCA
TGGTCCAAATTATCTTTCTCTTTTTTTCCTCTAATTAAGTCATATCACACAATTGTTTTTAGCCTTTAAATGATTAATCTACAGTCCAAACTATCTCCCT[AC/AT,C]
TTTTCTTTTTCCATAAAGTCATACCATTTTACTTTTTATGTTTGAATCACCATTCTACATACTATTTAAATTTAAATTATCATAAACCACATTAATTTAC
| Populations | Population Size | Frequency of GT(primary allele) | Frequency of AT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 10.60% | 16.97% | 13.67% | G: 0.04% |
| All Indica | 2759 | 32.90% | 17.50% | 27.44% | 22.18% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.13% | 0.20% | G: 0.07% |
| Aus | 269 | 78.80% | 3.70% | 11.52% | 5.95% | NA |
| Indica I | 595 | 4.90% | 16.80% | 49.58% | 28.74% | NA |
| Indica II | 465 | 23.40% | 18.10% | 28.17% | 30.32% | NA |
| Indica III | 913 | 53.80% | 15.60% | 13.91% | 16.76% | NA |
| Indica Intermediate | 786 | 35.50% | 19.80% | 25.95% | 18.70% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.00% | 0.40% | G: 0.20% |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 62.20% | 7.80% | 13.33% | 15.56% | G: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334732696 | GT -> DEL | N | N | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> AT | LOC_Os03g61140.1 | upstream_gene_variant ; 1163.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> AT | LOC_Os03g61140.2 | upstream_gene_variant ; 1165.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> AT | LOC_Os03g61150.1 | downstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> AT | LOC_Os03g61150.2 | downstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> AT | LOC_Os03g61150.3 | downstream_gene_variant ; 775.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> AT | LOC_Os03g61140-LOC_Os03g61150 | intergenic_region ; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> G | LOC_Os03g61140.1 | upstream_gene_variant ; 1164.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> G | LOC_Os03g61140.2 | upstream_gene_variant ; 1166.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> G | LOC_Os03g61150.1 | downstream_gene_variant ; 756.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> G | LOC_Os03g61150.2 | downstream_gene_variant ; 756.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> G | LOC_Os03g61150.3 | downstream_gene_variant ; 774.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0334732696 | GT -> G | LOC_Os03g61140-LOC_Os03g61150 | intergenic_region ; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334732696 | NA | 1.99E-09 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0334732696 | NA | 4.06E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | NA | 3.08E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | NA | 1.87E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | NA | 5.99E-09 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 3.26E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 7.25E-07 | 1.16E-07 | mr1305_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 7.62E-07 | 1.21E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | NA | 2.29E-06 | mr1409_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 4.85E-08 | 5.56E-13 | mr1649_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 5.63E-07 | 6.26E-06 | mr1649_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 3.16E-06 | NA | mr1765_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | 3.97E-06 | 3.97E-06 | mr1765_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334732696 | NA | 3.09E-09 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |