Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334694264:

Variant ID: vg0334694264 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34694264
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGCAGCAAAACTGTAAAACTAAACAACGCAGCATTCTAGAATACTAATTACAATCAGCTCGTTACTTTATACACGTGACACTATCATAAGTGTTGAC[C/A]
CTGAAAATTGTGAAAAAGTACAGATATAACAATGCAGTAAAAACAGAAGATGCAAGCAACAATTTAACATACTGATCAGTGGAATTCCAGTTGATAACCT

Reverse complement sequence

AGGTTATCAACTGGAATTCCACTGATCAGTATGTTAAATTGTTGCTTGCATCTTCTGTTTTTACTGCATTGTTATATCTGTACTTTTTCACAATTTTCAG[G/T]
GTCAACACTTATGATAGTGTCACGTGTATAAAGTAACGAGCTGATTGTAATTAGTATTCTAGAATGCTGCGTTGTTTAGTTTTACAGTTTTGCTGCCATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	10.20%	0.00%	0.00%	NA
All Indica	2759	89.90%	10.10%	0.00%	0.00%	NA
All Japonica	1512	98.40%	1.60%	0.00%	0.00%	NA
Aus	269	41.30%	58.70%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	90.10%	9.90%	0.00%	0.00%	NA
Indica III	913	86.50%	13.50%	0.00%	0.00%	NA
Indica Intermediate	786	87.20%	12.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334694264	C -> A	LOC_Os03g61060.1	upstream_gene_variant ; 3527.0bp to feature; MODIFIER	silent_mutation	Average:41.687; most accessible tissue: Callus, score: 76.138	N	N	N	N
vg0334694264	C -> A	LOC_Os03g61060.2	upstream_gene_variant ; 3587.0bp to feature; MODIFIER	silent_mutation	Average:41.687; most accessible tissue: Callus, score: 76.138	N	N	N	N
vg0334694264	C -> A	LOC_Os03g61070.1	intron_variant ; MODIFIER	silent_mutation	Average:41.687; most accessible tissue: Callus, score: 76.138	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334694264	NA	8.21E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	NA	2.43E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	5.76E-07	NA	mr1655	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	4.00E-06	4.00E-06	mr1655	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	NA	1.18E-08	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	4.49E-06	6.95E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	3.55E-07	NA	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264	9.68E-06	NA	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251