Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334413233:

Variant ID: vg0334413233 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34413233
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGCTCTTCGCGGTGGTGGAATTCCGGCACCGCTGTTCGGGTGCGGTTCGAGTGGGCGCGGTCTCTGATCTAGGGTTTTGGAGCTCCTTCTGTTCGGGT[G/C]
ACGGGTGGTCAAGAGCTGGAGGGATTTTCTCTGACAGAAATTGTTTCGAACGCTGCCGGTCATGCATTGGAGCTTGGTTGGTTGAAATATTGTTTACGTT

Reverse complement sequence

AACGTAAACAATATTTCAACCAACCAAGCTCCAATGCATGACCGGCAGCGTTCGAAACAATTTCTGTCAGAGAAAATCCCTCCAGCTCTTGACCACCCGT[C/G]
ACCCGAACAGAAGGAGCTCCAAAACCCTAGATCAGAGACCGCGCCCACTCGAACCGCACCCGAACAGCGGTGCCGGAATTCCACCACCGCGAAGAGCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 15.20% 0.00% 0.00% NA
All Indica  2759 82.90% 17.10% 0.00% 0.00% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 21.20% 78.80% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 75.70% 24.30% 0.00% 0.00% NA
Indica Intermediate  786 77.90% 22.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334413233 G -> C LOC_Os03g60540.1 upstream_gene_variant ; 1811.0bp to feature; MODIFIER silent_mutation Average:93.66; most accessible tissue: Zhenshan97 flag leaf, score: 96.469 N N N N
vg0334413233 G -> C LOC_Os03g60530.1 downstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:93.66; most accessible tissue: Zhenshan97 flag leaf, score: 96.469 N N N N
vg0334413233 G -> C LOC_Os03g60530.3 downstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:93.66; most accessible tissue: Zhenshan97 flag leaf, score: 96.469 N N N N
vg0334413233 G -> C LOC_Os03g60550.1 intron_variant ; MODIFIER silent_mutation Average:93.66; most accessible tissue: Zhenshan97 flag leaf, score: 96.469 N N N N
vg0334413233 G -> C LOC_Os03g60550.2 intron_variant ; MODIFIER silent_mutation Average:93.66; most accessible tissue: Zhenshan97 flag leaf, score: 96.469 N N N N
vg0334413233 G -> C LOC_Os03g60550.3 intron_variant ; MODIFIER silent_mutation Average:93.66; most accessible tissue: Zhenshan97 flag leaf, score: 96.469 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334413233 G C 0.0 0.01 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334413233 NA 2.34E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 NA 3.48E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 1.93E-06 NA mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 NA 8.20E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 5.47E-07 NA mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 NA 1.13E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 5.53E-07 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 NA 2.19E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334413233 NA 3.22E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251