| Variant ID: vg0333662864 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33662864 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCACTTTCAGTGAAATTGGCGATTTCCATATGTCCATCCCTCTAAGGTTAGAGAAACGCCAAGGGATCTTTTAGCTAGCTCCACAAGATGGTGGGCTAG[C/T]
CGGCCAGTGTTCGAAGTCTCACCCTTTCTATTTATTTAATATTAGGTATTTTCCTAATATTTGTGTTTTTTTTTTCATCCCTCTAAGGTCCCTAACACAA
TTGTGTTAGGGACCTTAGAGGGATGAAAAAAAAAACACAAATATTAGGAAAATACCTAATATTAAATAAATAGAAAGGGTGAGACTTCGAACACTGGCCG[G/A]
CTAGCCCACCATCTTGTGGAGCTAGCTAAAAGATCCCTTGGCGTTTCTCTAACCTTAGAGGGATGGACATATGGAAATCGCCAATTTCACTGAAAGTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 18.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 79.10% | 20.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.80% | 23.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 78.20% | 21.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333662864 | C -> T | LOC_Os03g59140.1 | upstream_gene_variant ; 4849.0bp to feature; MODIFIER | silent_mutation | Average:39.554; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0333662864 | C -> T | LOC_Os03g59120.1 | downstream_gene_variant ; 910.0bp to feature; MODIFIER | silent_mutation | Average:39.554; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0333662864 | C -> T | LOC_Os03g59120-LOC_Os03g59140 | intergenic_region ; MODIFIER | silent_mutation | Average:39.554; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333662864 | NA | 8.66E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | NA | 1.14E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | NA | 1.07E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | NA | 2.23E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | 3.58E-06 | NA | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | NA | 7.34E-08 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | NA | 4.79E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | NA | 3.93E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | 6.28E-07 | 7.47E-07 | mr1834_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333662864 | 3.17E-07 | 2.14E-08 | mr1834_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |