Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333248231:

Variant ID: vg0333248231 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33248231
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.38, A: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGAGAGCCATTCCATTTAGGGCGAGACAGAATGGGCGGGCACAAGCGGTCTGGTGTCCGAGCCGATTGGTCAGACGGTGAAGAAGTTATCACGAACA[C/T]
CTTATTGTCGAGAGTTAATTATCTGAATATTCTTTTGATTATATTATTGGGAATTGATTTTTATAGATGGATATAGTCCGAAGTTAGTTTTTTTTTTTAA

Reverse complement sequence

TTAAAAAAAAAAACTAACTTCGGACTATATCCATCTATAAAAATCAATTCCCAATAATATAATCAAAAGAATATTCAGATAATTAACTCTCGACAATAAG[G/A]
TGTTCGTGATAACTTCTTCACCGTCTGACCAATCGGCTCGGACACCAGACCGCTTGTGCCCGCCCATTCTGTCTCGCCCTAAATGGAATGGCTCTCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.30%	5.50%	1.33%	62.80%	NA
All Indica	2759	1.00%	1.90%	0.80%	96.30%	NA
All Japonica	1512	90.50%	6.40%	2.05%	1.06%	NA
Aus	269	0.00%	3.30%	0.74%	95.91%	NA
Indica I	595	0.20%	1.30%	0.84%	97.65%	NA
Indica II	465	3.20%	0.00%	0.86%	95.91%	NA
Indica III	913	0.20%	2.00%	0.11%	97.70%	NA
Indica Intermediate	786	1.30%	3.30%	1.53%	93.89%	NA
Temperate Japonica	767	96.60%	0.70%	1.69%	1.04%	NA
Tropical Japonica	504	88.70%	9.30%	0.60%	1.39%	NA
Japonica Intermediate	241	74.70%	18.70%	6.22%	0.41%	NA
VI/Aromatic	96	5.20%	92.70%	1.04%	1.04%	NA
Intermediate	90	35.60%	16.70%	7.78%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333248231	C -> T	LOC_Os03g58350.1	upstream_gene_variant ; 913.0bp to feature; MODIFIER	silent_mutation	Average:77.171; most accessible tissue: Minghui63 flag leaf, score: 99.98	N	N	N	N
vg0333248231	C -> T	LOC_Os03g58340.1	downstream_gene_variant ; 3421.0bp to feature; MODIFIER	silent_mutation	Average:77.171; most accessible tissue: Minghui63 flag leaf, score: 99.98	N	N	N	N
vg0333248231	C -> T	LOC_Os03g58364.1	downstream_gene_variant ; 4189.0bp to feature; MODIFIER	silent_mutation	Average:77.171; most accessible tissue: Minghui63 flag leaf, score: 99.98	N	N	N	N
vg0333248231	C -> T	LOC_Os03g58350-LOC_Os03g58364	intergenic_region ; MODIFIER	silent_mutation	Average:77.171; most accessible tissue: Minghui63 flag leaf, score: 99.98	N	N	N	N
vg0333248231	C -> DEL	N	N	silent_mutation	Average:77.171; most accessible tissue: Minghui63 flag leaf, score: 99.98	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0333248231	C	T	0.0	0.01	-0.01	-0.01	-0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333248231	NA	7.64E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	1.09E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	3.42E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	4.06E-50	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	8.30E-59	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	2.32E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	4.49E-06	2.46E-11	mr1730	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	1.18E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	2.77E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	3.18E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	4.28E-58	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333248231	NA	1.19E-20	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251