Variant ID: vg0332499847 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 32499847 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 115. )
TATAAAAATATTGAGAGTTGAACGCGGGTACTAATAAAGTACTCCCTCTATATTTTAATGTAATGTATGACGTCGTTGACTTTTTTATCAATATTTAATT[A/G]
TTTGTCTTATTCAAATTTTTTTATGTAAATATAAAAATATTTATATCATGCTTAAAAAATATTTGATGATAAATTAAGTCACAATGAAATAAATGATAAT
ATTATCATTTATTTCATTGTGACTTAATTTATCATCAAATATTTTTTAAGCATGATATAAATATTTTTATATTTACATAAAAAAATTTGAATAAGACAAA[T/C]
AATTAAATATTGATAAAAAAGTCAACGACGTCATACATTACATTAAAATATAGAGGGAGTACTTTATTAGTACCCGCGTTCAACTCTCAATATTTTTATA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.80% | 14.90% | 0.32% | 0.00% | NA |
All Indica | 2759 | 84.50% | 15.00% | 0.51% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 90.60% | 9.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 87.30% | 11.80% | 0.86% | 0.00% | NA |
Indica III | 913 | 83.60% | 16.20% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 79.40% | 19.70% | 0.89% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 7.30% | 1.04% | 0.00% | NA |
Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0332499847 | A -> G | LOC_Os03g57020-LOC_Os03g57030 | intergenic_region ; MODIFIER | silent_mutation | Average:27.869; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0332499847 | NA | 4.13E-09 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 9.74E-07 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 3.41E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 3.81E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 4.72E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 9.31E-09 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 1.83E-06 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 2.03E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 1.15E-08 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0332499847 | NA | 2.16E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/