Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330889700:

Variant ID: vg0330889700 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30889700
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAAGACTCTGTCAATATCGCCACGTAGGCGCCACATCAGCAAAACCACCCTCCAAAACCGCTGAGGGAGTCAAATTGCATCGGTTTTAACAGTTTAG[A/G]
GATCAACATATCTGGTTTTGGAGTTCAGGGTCACGAATTAGATTCGGGTCACTTTTGAGGGAGTCAAAGTGAACTTATTCTTTAATAAGCAGATGCACAC

Reverse complement sequence

GTGTGCATCTGCTTATTAAAGAATAAGTTCACTTTGACTCCCTCAAAAGTGACCCGAATCTAATTCGTGACCCTGAACTCCAAAACCAGATATGTTGATC[T/C]
CTAAACTGTTAAAACCGATGCAATTTGACTCCCTCAGCGGTTTTGGAGGGTGGTTTTGCTGATGTGGCGCCTACGTGGCGATATTGACAGAGTCTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 47.20% 0.04% 0.00% NA
All Indica  2759 78.80% 21.10% 0.07% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 61.50% 38.30% 0.22% 0.00% NA
Indica III  913 72.80% 27.20% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330889700 A -> G LOC_Os03g53860.1 downstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53880.1 downstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53860.2 downstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53860.3 downstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53860.5 downstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53860.4 downstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53880.2 downstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53880.3 downstream_gene_variant ; 3936.0bp to feature; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N
vg0330889700 A -> G LOC_Os03g53860-LOC_Os03g53880 intergenic_region ; MODIFIER silent_mutation Average:97.55; most accessible tissue: Zhenshan97 panicle, score: 98.763 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330889700 A G -0.01 0.0 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330889700 9.65E-06 1.84E-15 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 7.28E-10 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 3.65E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.30E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.26E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 4.62E-07 4.32E-20 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 1.48E-06 1.43E-12 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 2.99E-09 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 5.21E-07 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 2.17E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 4.32E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.12E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 5.41E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 2.13E-06 6.15E-10 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.27E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 2.49E-08 6.31E-14 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 5.63E-09 6.44E-22 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 4.45E-06 6.75E-24 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.69E-12 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 4.96E-22 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 8.95E-13 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.94E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 3.34E-06 2.79E-58 mr1935 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 4.09E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 5.67E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.01E-08 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 1.31E-06 1.10E-15 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 5.12E-07 1.17E-12 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.01E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.25E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 5.11E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.90E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.49E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 7.67E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 3.09E-10 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 1.00E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 2.43E-06 9.48E-16 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 4.54E-08 1.48E-25 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 8.43E-24 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 3.39E-14 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 4.44E-24 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 3.00E-18 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 5.01E-27 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330889700 NA 6.04E-09 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251