Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330839138:

Variant ID: vg0330839138 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30839138
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCTACTTGACATGCAATAAACGGATGGATGTTCAATCGAGCTATTAGAATCCATCTCCCTTGCGTGTGCGGGAAGTGTTTGTGTGCTTGTTGCAACC[A/G]
TTGCAGACGCTGTTCCGATTTAGTTGGTGTGCATCGTGTTCGTGTGCTTGTTGCAAACGCTTTTCACTCTAGTTGGATTTAGTTGGTGTGCGTGTGCGGG

Reverse complement sequence

CCCGCACACGCACACCAACTAAATCCAACTAGAGTGAAAAGCGTTTGCAACAAGCACACGAACACGATGCACACCAACTAAATCGGAACAGCGTCTGCAA[T/C]
GGTTGCAACAAGCACACAAACACTTCCCGCACACGCAAGGGAGATGGATTCTAATAGCTCGATTGAACATCCATCCGTTTATTGCATGTCAAGTAGATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.10% 0.91% 0.00% NA
All Indica  2759 74.70% 24.10% 1.12% 0.00% NA
All Japonica  1512 0.40% 99.50% 0.07% 0.00% NA
Aus  269 95.50% 0.70% 3.72% 0.00% NA
Indica I  595 90.10% 6.70% 3.19% 0.00% NA
Indica II  465 57.60% 41.90% 0.43% 0.00% NA
Indica III  913 71.10% 28.60% 0.33% 0.00% NA
Indica Intermediate  786 77.50% 21.60% 0.89% 0.00% NA
Temperate Japonica  767 0.10% 99.70% 0.13% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330839138 A -> G LOC_Os03g53790.1 downstream_gene_variant ; 961.0bp to feature; MODIFIER silent_mutation Average:37.955; most accessible tissue: Callus, score: 49.918 N N N N
vg0330839138 A -> G LOC_Os03g53790-LOC_Os03g53800 intergenic_region ; MODIFIER silent_mutation Average:37.955; most accessible tissue: Callus, score: 49.918 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330839138 NA 4.86E-15 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 9.72E-10 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 2.51E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 5.93E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 5.36E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.63E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 8.26E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 7.33E-07 7.06E-20 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 9.94E-07 7.28E-13 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 3.65E-09 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 3.13E-07 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 2.71E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 3.30E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.32E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 2.47E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 3.73E-11 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 6.00E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.49E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 8.09E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.76E-09 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 6.72E-16 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 1.28E-10 1.79E-15 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 3.69E-13 1.87E-26 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 9.33E-08 9.67E-26 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 2.71E-08 8.70E-16 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 4.06E-22 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 2.04E-13 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 4.56E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 4.26E-07 4.04E-58 mr1935 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 3.88E-06 4.92E-11 mr1935 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 5.94E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 4.56E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.86E-08 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.42E-14 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 1.54E-06 2.19E-12 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 4.03E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 6.62E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 5.84E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.97E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.57E-10 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 9.36E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 1.49E-06 2.75E-16 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 7.21E-08 2.38E-26 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 6.46E-24 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 2.24E-14 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.85E-24 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 1.27E-18 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 3.26E-27 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330839138 NA 2.61E-09 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251