Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330601042:

Variant ID: vg0330601042 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 30601042
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCACAAAGTTTACATATCTCTCTTATAGTCTATAGAACCAGATGAGATAGATGTAAATTTTGTGAACAAAGTTACTATCACTTTGTCGGATGAAAAAA[T/C]
GACCCAAATAAAATTTATAGATCTTGATGAGTTATGAAACTTTGTTGTTGATAACTTTTTCAGTTGAAATCATTTAGTATTTCAAAATGTTGTTTGAAGT

Reverse complement sequence

ACTTCAAACAACATTTTGAAATACTAAATGATTTCAACTGAAAAAGTTATCAACAACAAAGTTTCATAACTCATCAAGATCTATAAATTTTATTTGGGTC[A/G]
TTTTTTCATCCGACAAAGTGATAGTAACTTTGTTCACAAAATTTACATCTATCTCATCTGGTTCTATAGACTATAAGAGAGATATGTAAACTTTGTGAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.20%	30.70%	0.06%	0.00%	NA
All Indica	2759	58.60%	41.20%	0.11%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	96.00%	4.00%	0.00%	0.00%	NA
Indica II	465	63.40%	36.10%	0.43%	0.00%	NA
Indica III	913	24.50%	75.50%	0.00%	0.00%	NA
Indica Intermediate	786	67.20%	32.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0330601042	T -> C	LOC_Os03g53310.1	upstream_gene_variant ; 1491.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53300.1	downstream_gene_variant ; 4983.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53320.1	downstream_gene_variant ; 1843.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53340.1	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53300.2	downstream_gene_variant ; 4983.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53340.6	downstream_gene_variant ; 2922.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53340.2	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53340.5	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53340.3	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53340.4	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N
vg0330601042	T -> C	LOC_Os03g53310-LOC_Os03g53320	intergenic_region ; MODIFIER	silent_mutation	Average:27.155; most accessible tissue: Callus, score: 38.064	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0330601042	NA	5.67E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	2.42E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	8.50E-10	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	8.79E-06	1.89E-11	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	6.32E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	3.43E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	1.26E-12	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	6.79E-07	1.16E-14	mr1842_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	3.83E-18	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	7.37E-12	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330601042	NA	2.60E-09	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251