Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330512638:

Variant ID: vg0330512638 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 30512638
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTTATATCTACTTCTTATTAAACTGTTATTTGGGTTTATATTCACGCCATCATGCTATGTGATCAAAGGGTAGCGGTCGGCGTGTGTCTTATGTGAC[G/A]
AATAGAAAAATCAAGATTTTAAAAGTTATTAAAGAGAAATAGAATTGTACCGTAGCGTTTAGCACGGGCATATTACTAGTTAGATACGATTAATTAAGTT

Reverse complement sequence

AACTTAATTAATCGTATCTAACTAGTAATATGCCCGTGCTAAACGCTACGGTACAATTCTATTTCTCTTTAATAACTTTTAAAATCTTGATTTTTCTATT[C/T]
GTCACATAAGACACACGCCGACCGCTACCCTTTGATCACATAGCATGATGGCGTGAATATAAACCCAAATAACAGTTTAATAAGAAGTAGATATAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	1.10%	0.34%	2.16%	NA
All Indica	2759	93.90%	1.80%	0.58%	3.70%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.20%	3.90%	2.02%	4.87%	NA
Indica II	465	99.40%	0.20%	0.00%	0.43%	NA
Indica III	913	98.70%	0.00%	0.00%	1.31%	NA
Indica Intermediate	786	88.50%	3.40%	0.51%	7.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0330512638	G -> A	LOC_Os03g53180.1	upstream_gene_variant ; 4647.0bp to feature; MODIFIER	silent_mutation	Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0330512638	G -> A	LOC_Os03g53190.1	upstream_gene_variant ; 1218.0bp to feature; MODIFIER	silent_mutation	Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0330512638	G -> A	LOC_Os03g53200.1	upstream_gene_variant ; 4898.0bp to feature; MODIFIER	silent_mutation	Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0330512638	G -> A	LOC_Os03g53190.2	upstream_gene_variant ; 1336.0bp to feature; MODIFIER	silent_mutation	Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0330512638	G -> A	LOC_Os03g53180-LOC_Os03g53190	intergenic_region ; MODIFIER	silent_mutation	Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0330512638	G -> DEL	N	N	silent_mutation	Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0330512638	NA	8.74E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	NA	6.65E-06	mr1171	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	1.68E-06	1.68E-06	mr1329	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	NA	3.89E-09	mr1457	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	NA	2.83E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	NA	1.55E-07	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	2.61E-09	2.61E-09	mr1524	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638	NA	4.58E-06	mr1673	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251