Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330512598:

Variant ID: vg0330512598 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 30512598
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GACAACCACTTGTTATCTTGTTATACATGGTAAAACTATTAATTTTATATCTACTTCTTATTAAACTGTTATTTGGGTTTATATTCACGCCATCATGCTA[T/G]
GTGATCAAAGGGTAGCGGTCGGCGTGTGTCTTATGTGACGAATAGAAAAATCAAGATTTTAAAAGTTATTAAAGAGAAATAGAATTGTACCGTAGCGTTT

Reverse complement sequence

AAACGCTACGGTACAATTCTATTTCTCTTTAATAACTTTTAAAATCTTGATTTTTCTATTCGTCACATAAGACACACGCCGACCGCTACCCTTTGATCAC[A/C]
TAGCATGATGGCGTGAATATAAACCCAAATAACAGTTTAATAAGAAGTAGATATAAAATTAATAGTTTTACCATGTATAACAAGATAACAAGTGGTTGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	1.50%	0.63%	5.78%	NA
All Indica	2759	86.40%	2.60%	1.09%	9.89%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.90%	4.50%	2.35%	7.23%	NA
Indica II	465	95.10%	0.60%	0.00%	4.30%	NA
Indica III	913	90.70%	0.10%	0.11%	9.09%	NA
Indica Intermediate	786	76.80%	5.10%	1.91%	16.16%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0330512598	T -> DEL	N	N	silent_mutation	Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972	N	N	N	N
vg0330512598	T -> G	LOC_Os03g53180.1	upstream_gene_variant ; 4607.0bp to feature; MODIFIER	silent_mutation	Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972	N	N	N	N
vg0330512598	T -> G	LOC_Os03g53190.1	upstream_gene_variant ; 1258.0bp to feature; MODIFIER	silent_mutation	Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972	N	N	N	N
vg0330512598	T -> G	LOC_Os03g53200.1	upstream_gene_variant ; 4938.0bp to feature; MODIFIER	silent_mutation	Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972	N	N	N	N
vg0330512598	T -> G	LOC_Os03g53190.2	upstream_gene_variant ; 1376.0bp to feature; MODIFIER	silent_mutation	Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972	N	N	N	N
vg0330512598	T -> G	LOC_Os03g53180-LOC_Os03g53190	intergenic_region ; MODIFIER	silent_mutation	Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0330512598	NA	8.47E-06	mr1171	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598	7.09E-06	7.09E-06	mr1329	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598	3.80E-06	NA	mr1457	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598	NA	1.04E-08	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598	NA	3.64E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598	1.56E-06	1.56E-06	mr1524	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598	NA	2.22E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251