Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330494102:

Variant ID: vg0330494102 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30494102
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTCAATTCCATCGCGATGTGATTTTCCGTCGTCTGTACGTACGTCGCGCTTTGCCTTCTCTCCACCGCGCGCGGCGGCGCGATTATGGTTGCCAGCTA[C/A]
TTTCTCTATTTTACAATGTAAGACTTTCTAACATTGTCCACATTTATATAGATGCTAATGAATCTAGGCACACACACATATATATATATATATTCATTAA

Reverse complement sequence

TTAATGAATATATATATATATATGTGTGTGTGCCTAGATTCATTAGCATCTATATAAATGTGGACAATGTTAGAAAGTCTTACATTGTAAAATAGAGAAA[G/T]
TAGCTGGCAACCATAATCGCGCCGCCGCGCGCGGTGGAGAGAAGGCAAAGCGCGACGTACGTACAGACGACGGAAAATCACATCGCGATGGAATTGAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 4.10% 0.17% 0.00% NA
All Indica  2759 93.10% 6.60% 0.22% 0.00% NA
All Japonica  1512 99.10% 0.70% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.10% 11.40% 0.50% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 87.00% 12.60% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.20% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330494102 C -> A LOC_Os03g53160-LOC_Os03g53170 intergenic_region ; MODIFIER silent_mutation Average:69.97; most accessible tissue: Minghui63 flower, score: 90.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330494102 C A -0.04 -0.05 -0.03 -0.04 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330494102 9.66E-06 9.66E-06 mr1329 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 NA 3.91E-08 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 NA 3.81E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 NA 3.65E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 NA 3.30E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 4.26E-08 NA mr1524 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 1.32E-08 1.31E-08 mr1524 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330494102 NA 4.64E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251