Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330364714:

Variant ID: vg0330364714 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30364714
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGAGAGACATCGGCAATTGCATAAGAATATTAGTGGTAGCAGCTAGCCGATCCAATCTTTGTCAAATCCTGCATTGCACGACTGTCCATGAACCAACC[A/G]
TTTTCACTTTTAACCTCGCTTTTTTATCTTCTACCTTATCCTGCACCTCTTATCCCTGAGCGTAATTGATCTGATTGAGTACTTACAGTATCTGACAGGC

Reverse complement sequence

GCCTGTCAGATACTGTAAGTACTCAATCAGATCAATTACGCTCAGGGATAAGAGGTGCAGGATAAGGTAGAAGATAAAAAAGCGAGGTTAAAAGTGAAAA[T/C]
GGTTGGTTCATGGACAGTCGTGCAATGCAGGATTTGACAAAGATTGGATCGGCTAGCTGCTACCACTAATATTCTTATGCAATTGCCGATGTCTCTCCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.40% 0.28% 0.00% NA
All Indica  2759 63.50% 36.00% 0.47% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 56.50% 42.90% 0.67% 0.00% NA
Indica II  465 49.90% 49.50% 0.65% 0.00% NA
Indica III  913 69.60% 30.20% 0.22% 0.00% NA
Indica Intermediate  786 69.80% 29.60% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330364714 A -> G LOC_Os03g52940.1 upstream_gene_variant ; 4239.0bp to feature; MODIFIER silent_mutation Average:76.162; most accessible tissue: Zhenshan97 flower, score: 94.855 N N N N
vg0330364714 A -> G LOC_Os03g52930.1 downstream_gene_variant ; 4816.0bp to feature; MODIFIER silent_mutation Average:76.162; most accessible tissue: Zhenshan97 flower, score: 94.855 N N N N
vg0330364714 A -> G LOC_Os03g52930-LOC_Os03g52940 intergenic_region ; MODIFIER silent_mutation Average:76.162; most accessible tissue: Zhenshan97 flower, score: 94.855 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330364714 A G 0.09 0.07 0.06 0.01 0.05 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330364714 NA 5.88E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 6.62E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 6.62E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 5.33E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 4.15E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 6.66E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 1.88E-11 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 6.80E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 2.13E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 1.45E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 8.98E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 2.29E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 6.32E-07 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 6.88E-11 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 1.17E-06 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 2.84E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 7.75E-13 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 4.56E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 1.18E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 4.00E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 4.10E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330364714 NA 5.17E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251