Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330295614:

Variant ID: vg0330295614 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 30295614
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGTTTCTGAGCAAGTTGACCATCTTCTCAAGCAAGCGACAAGCATTGACAATTTGTGCAATATGTATGAGGGGTGGACACCTTGGATATGATTCAAAG[A/G]
TACATGTGAACATGTCTTTCTACGATTTGTTTTTTCCAGGTATCAACTGAAAATATAAGATCCCCCTATAGGTTTGTTTAGTACCTTGTGATAGAAGGGG

Reverse complement sequence

CCCCTTCTATCACAAGGTACTAAACAAACCTATAGGGGGATCTTATATTTTCAGTTGATACCTGGAAAAAACAAATCGTAGAAAGACATGTTCACATGTA[T/C]
CTTTGAATCATATCCAAGGTGTCCACCCCTCATACATATTGCACAAATTGTCAATGCTTGTCGCTTGCTTGAGAAGATGGTCAACTTGCTCAGAAACCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.10%	1.70%	0.15%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	94.60%	5.00%	0.40%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	84.50%	14.30%	1.19%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0330295614	A -> G	LOC_Os03g52820.1	upstream_gene_variant ; 3704.0bp to feature; MODIFIER	silent_mutation	Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0330295614	A -> G	LOC_Os03g52840.1	upstream_gene_variant ; 3937.0bp to feature; MODIFIER	silent_mutation	Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0330295614	A -> G	LOC_Os03g52840.2	upstream_gene_variant ; 3937.0bp to feature; MODIFIER	silent_mutation	Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0330295614	A -> G	LOC_Os03g52840.3	upstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0330295614	A -> G	LOC_Os03g52830.1	downstream_gene_variant ; 8.0bp to feature; MODIFIER	silent_mutation	Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0330295614	A -> G	LOC_Os03g52830-LOC_Os03g52840	intergenic_region ; MODIFIER	silent_mutation	Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0330295614	NA	2.94E-07	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	4.56E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	5.79E-07	5.79E-07	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	3.20E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	1.46E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	5.95E-08	5.95E-08	mr1562_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	4.12E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	8.37E-06	8.37E-06	mr1605_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	5.48E-07	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	6.91E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	6.40E-07	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	3.92E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614	NA	6.90E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251