Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329606112:

Variant ID: vg0329606112 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 29606112
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.42, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTGAGCTAGCTCTCACTCCTCTCCCTCTCAATATCAAGCTATAAGCCATAAGCCAGCTGCAAATATATTTTAAGAAGATAAATGAAGAGAGAAGAGCA[G/A]
CGGGCTACAGATTTGTAGTCAGCTATAGCACAGACTCAGTGTGTATGATAGATGGGACCAGATATTAATAATGTAGTATATAACTATTGTATGAATAAGC

Reverse complement sequence

GCTTATTCATACAATAGTTATATACTACATTATTAATATCTGGTCCCATCTATCATACACACTGAGTCTGTGCTATAGCTGACTACAAATCTGTAGCCCG[C/T]
TGCTCTTCTCTCTTCATTTATCTTCTTAAAATATATTTGCAGCTGGCTTATGGCTTATAGCTTGATATTGAGAGGGAGAGGAGTGAGAGCTAGCTCAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 20.90% 0.04% 0.00% NA
All Indica  2759 64.40% 35.50% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 7.40% 92.60% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 82.30% 17.70% 0.00% 0.00% NA
Indica Intermediate  786 67.40% 32.30% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0329606112 G -> A LOC_Os03g51690.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:72.295; most accessible tissue: Zhenshan97 panicle, score: 99.242 N N N N
vg0329606112 G -> A LOC_Os03g51690.2 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:72.295; most accessible tissue: Zhenshan97 panicle, score: 99.242 N N N N
vg0329606112 G -> A LOC_Os03g51690.1 5_prime_UTR_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:72.295; most accessible tissue: Zhenshan97 panicle, score: 99.242 N N N N
vg0329606112 G -> A LOC_Os03g51690.2 5_prime_UTR_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:72.295; most accessible tissue: Zhenshan97 panicle, score: 99.242 N N N N
vg0329606112 G -> A LOC_Os03g51690.3 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:72.295; most accessible tissue: Zhenshan97 panicle, score: 99.242 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0329606112 G A -0.02 -0.02 -0.01 0.04 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0329606112 NA 2.10E-12 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329606112 NA 1.45E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.85E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.25E-07 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.24E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 4.23E-11 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 6.45E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.20E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.11E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.35E-20 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.50E-13 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 7.35E-18 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.79E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.91E-07 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 9.07E-07 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 6.15E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.28E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 6.79E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.16E-11 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.19E-08 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 4.55E-07 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.10E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 5.99E-09 mr1502 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.34E-09 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.16E-17 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 6.87E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.79E-17 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 5.22E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.11E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 5.20E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 4.01E-09 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 6.47E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.72E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.38E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.39E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.53E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.36E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.33E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.03E-07 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 9.67E-07 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 5.35E-19 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 8.03E-13 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.03E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 4.19E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 5.04E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.10E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 4.24E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 3.56E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 4.16E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 7.79E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.81E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.37E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 1.10E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329606112 NA 2.15E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251