RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0329497105:

Variant ID: vg0329497105 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 29497105
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.17, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTCAGTTACTTCTAAATTGTTAAATTGTATTCCTATATTGAATTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATT[G/T]
TATTTTTATACGGACTCTAAACTCTACTTTTAATTTTTTTATGTTTATTCCGAATTTTATTTAGTTTTGAATTTCTACATGGACTCTATACTCTACTTCT

Reverse complement sequence

AGAAGTAGAGTATAGAGTCCATGTAGAAATTCAAAACTAAATAAAATTCGGAATAAACATAAAAAAATTAAAAGTAGAGTTTAGAGTCCGTATAAAAATA[C/A]
AATTTACAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAATTCAATATAGGAATACAATTTAACAATTTAGAAGTAACTGAAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	31.50%	0.93%	0.44%	NA
All Indica	2759	44.60%	53.10%	1.56%	0.72%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	36.50%	59.50%	4.03%	0.00%	NA
Indica II	465	49.70%	47.30%	0.86%	2.15%	NA
Indica III	913	47.10%	51.80%	0.88%	0.22%	NA
Indica Intermediate	786	44.90%	53.20%	0.89%	1.02%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	0.00%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0329497105	G -> T	LOC_Os03g51556.1	upstream_gene_variant ; 2169.0bp to feature; MODIFIER	silent_mutation	Average:20.288; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0329497105	G -> T	LOC_Os03g51556-LOC_Os03g51570	intergenic_region ; MODIFIER	silent_mutation	Average:20.288; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0329497105	G -> DEL	N	N	silent_mutation	Average:20.288; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0329497105	8.49E-06	NA	mr1328	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329497105	NA	1.75E-09	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329497105	NA	2.24E-08	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329497105	NA	2.17E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329497105	NA	1.03E-06	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0329497105:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact