Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329034942:

Variant ID: vg0329034942 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 29034942
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCATCTATTTGTAAATTGTATTTCTATATAAACTCATATTTCAATATTCTTTAAATTTTAATTTCAAATTTCAATTACTTCTAAATTGTATTTCTATA[T/C]
TGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTATAAATTGTATTTTTATACGGACTCTGAACTCTACTTCTAATATTCC

Reverse complement sequence

GGAATATTAGAAGTAGAGTTCAGAGTCCGTATAAAAATACAATTTATAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCA[A/G]
TATAGAAATACAATTTAGAAGTAATTGAAATTTGAAATTAAAATTTAAAGAATATTGAAATATGAGTTTATATAGAAATACAATTTACAAATAGATGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	17.90%	0.74%	0.00%	NA
All Indica	2759	69.30%	29.50%	1.27%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	48.60%	51.20%	0.22%	0.00%	NA
Indica III	913	56.00%	40.90%	3.18%	0.00%	NA
Indica Intermediate	786	74.40%	24.90%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0329034942	T -> C	LOC_Os03g50820.1	downstream_gene_variant ; 3966.0bp to feature; MODIFIER	silent_mutation	Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0329034942	T -> C	LOC_Os03g50830.1	downstream_gene_variant ; 2693.0bp to feature; MODIFIER	silent_mutation	Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0329034942	T -> C	LOC_Os03g50850.1	downstream_gene_variant ; 4352.0bp to feature; MODIFIER	silent_mutation	Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0329034942	T -> C	LOC_Os03g50850.2	downstream_gene_variant ; 4352.0bp to feature; MODIFIER	silent_mutation	Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0329034942	T -> C	LOC_Os03g50830-LOC_Os03g50850	intergenic_region ; MODIFIER	silent_mutation	Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0329034942	NA	3.40E-07	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	1.78E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	3.48E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	2.53E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	7.73E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	7.06E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	7.45E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	8.33E-06	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	1.67E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	4.47E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	6.18E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	6.22E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	1.68E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	5.03E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	3.43E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	1.11E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	2.33E-09	mr1958	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	7.70E-08	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942	NA	3.33E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251