Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328664608:

Variant ID: vg0328664608 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28664608
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCGAGGTCAGATCTGATGCGAAAGTTTAGGGTTCTTGGTGACTGTGAGATGTGGCTGTGTTTAGTTCACGCCGAAGTTGTAAGTTTGGTTGAAAATTG[G/C]
AACGATGTGATTGAAAGTTTGTGTGTGTATGACAGGTTGATGTGATGGGAAAAGTTAGAAGTTTGGAAAAAAACTTTGGAACTAAACACACCTCGTTTTA

Reverse complement sequence

TAAAACGAGGTGTGTTTAGTTCCAAAGTTTTTTTCCAAACTTCTAACTTTTCCCATCACATCAACCTGTCATACACACACAAACTTTCAATCACATCGTT[C/G]
CAATTTTCAACCAAACTTACAACTTCGGCGTGAACTAAACACAGCCACATCTCACAGTCACCAAGAACCCTAAACTTTCGCATCAGATCTGACCTCGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 44.50% 3.70% 0.13% NA
All Indica  2759 67.80% 28.70% 3.48% 0.04% NA
All Japonica  1512 33.90% 61.00% 4.83% 0.26% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 84.70% 7.20% 8.07% 0.00% NA
Indica II  465 38.90% 59.10% 1.72% 0.22% NA
Indica III  913 72.30% 27.70% 0.00% 0.00% NA
Indica Intermediate  786 66.80% 28.10% 5.09% 0.00% NA
Temperate Japonica  767 23.90% 70.50% 5.35% 0.26% NA
Tropical Japonica  504 41.90% 55.40% 2.38% 0.40% NA
Japonica Intermediate  241 49.00% 42.70% 8.30% 0.00% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 37.80% 55.60% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328664608 G -> C LOC_Os03g50290.1 intron_variant ; MODIFIER silent_mutation Average:89.434; most accessible tissue: Minghui63 flag leaf, score: 97.125 N N N N
vg0328664608 G -> C LOC_Os03g50290.3 intron_variant ; MODIFIER silent_mutation Average:89.434; most accessible tissue: Minghui63 flag leaf, score: 97.125 N N N N
vg0328664608 G -> C LOC_Os03g50290.2 intron_variant ; MODIFIER silent_mutation Average:89.434; most accessible tissue: Minghui63 flag leaf, score: 97.125 N N N N
vg0328664608 G -> DEL N N silent_mutation Average:89.434; most accessible tissue: Minghui63 flag leaf, score: 97.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0328664608 G C -0.02 -0.02 -0.01 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328664608 NA 1.87E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0328664608 NA 8.01E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 2.17E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 6.45E-07 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 9.15E-09 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 9.97E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 2.43E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 7.44E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 7.44E-08 mr1684 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 3.60E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 3.33E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 1.45E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328664608 NA 6.19E-08 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251