Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328193610:

Variant ID: vg0328193610 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28193610
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGACGATGCGACTGAGGAGGCGGACAAGGCGGCGACGGCGGGGGATACAGACGGTGACGGAGGGGGCGGACAAGGCGGCGAGGCCGGGGGAGGAATAG[C/T,A]
GAGGTGTCTGCATGCGACGGAGTCCGGACCTGATGCGATGCGAACCGAAGAAAACATCCCAAACCAAAATTACCCCTAAACGATATTAGGAGATTACTTA

Reverse complement sequence

TAAGTAATCTCCTAATATCGTTTAGGGGTAATTTTGGTTTGGGATGTTTTCTTCGGTTCGCATCGCATCAGGTCCGGACTCCGTCGCATGCAGACACCTC[G/A,T]
CTATTCCTCCCCCGGCCTCGCCGCCTTGTCCGCCCCCTCCGTCACCGTCTGTATCCCCCGCCGTCGCCGCCTTGTCCGCCTCCTCAGTCGCATCGTCCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	3.00%	1.97%	0.19%	NA
All Indica	2759	91.50%	4.90%	3.30%	0.33%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.00%	1.00%	2.02%	0.00%	NA
Indica II	465	79.10%	15.90%	4.95%	0.00%	NA
Indica III	913	92.20%	3.20%	3.61%	0.99%	NA
Indica Intermediate	786	93.90%	3.20%	2.93%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328193610	C -> T	LOC_Os03g49520.1	upstream_gene_variant ; 3495.0bp to feature; MODIFIER	N	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> T	LOC_Os03g49520.2	upstream_gene_variant ; 3495.0bp to feature; MODIFIER	N	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> T	LOC_Os03g49524.1	downstream_gene_variant ; 175.0bp to feature; MODIFIER	N	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> T	LOC_Os03g49520-LOC_Os03g49524	intergenic_region ; MODIFIER	N	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> A	LOC_Os03g49520.1	upstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> A	LOC_Os03g49520.2	upstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> A	LOC_Os03g49524.1	downstream_gene_variant ; 175.0bp to feature; MODIFIER	silent_mutation	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> A	LOC_Os03g49520-LOC_Os03g49524	intergenic_region ; MODIFIER	silent_mutation	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0328193610	C -> DEL	N	N	silent_mutation	Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328193610	NA	2.12E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610	NA	8.19E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610	NA	6.06E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610	NA	6.09E-07	mr1482	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610	NA	6.59E-06	mr1806	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610	NA	1.93E-07	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251