Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328157393:

Variant ID: vg0328157393 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28157393
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTATTTGTTAGTTTTATTTCTTAAAATACTTAATTTATCCCTATAACAGGTAGATAATACTTTCTCTGTTTTTTAATAGATGTCGCCGTTGATTTTT[G/A]
AACCCACGTTTAACCATTCGTCTTATTAAAAAAATTTATGTGAATATATAAGATATAAATCATGCTTAAAGTACTTTGAGTAACAAAAATAACTCACAAC

Reverse complement sequence

GTTGTGAGTTATTTTTGTTACTCAAAGTACTTTAAGCATGATTTATATCTTATATATTCACATAAATTTTTTTAATAAGACGAATGGTTAAACGTGGGTT[C/T]
AAAAATCAACGGCGACATCTATTAAAAAACAGAGAAAGTATTATCTACCTGTTATAGGGATAAATTAAGTATTTTAAGAAATAAAACTAACAAATAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.00%	0.80%	0.00%	NA
All Indica	2759	92.00%	6.70%	1.30%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	68.40%	25.70%	5.88%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.20%	3.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328157393	G -> A	LOC_Os03g49480.1	downstream_gene_variant ; 2654.0bp to feature; MODIFIER	silent_mutation	Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0328157393	G -> A	LOC_Os03g49464.2	downstream_gene_variant ; 1963.0bp to feature; MODIFIER	silent_mutation	Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0328157393	G -> A	LOC_Os03g49464.1	intron_variant ; MODIFIER	silent_mutation	Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328157393	NA	9.98E-17	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	NA	4.43E-15	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	NA	1.44E-19	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	NA	8.64E-17	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	NA	7.04E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	2.53E-06	1.08E-22	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	6.27E-06	3.21E-20	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	NA	6.31E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	1.36E-07	8.03E-23	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393	1.13E-06	2.66E-21	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251