Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328066679:

Variant ID: vg0328066679 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28066679
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCCTCCTCCCACTCCTCTTATCTCCCGGCGACGGCGGCAGCGGCGGTCTCGGCTAGGGCGGCGGAGACGGAGACATCGGGTTAGAGTGGCGGAAGCGG[C/T]
GGCGGAGGCGAGTGCGGTGGCGGCATCAGCCATGGTGGTGGGAACGGAGCGGATGATTTTCGCAGACACCTCGTACTAGACGGGTGAAACATCCGCACGC

Reverse complement sequence

GCGTGCGGATGTTTCACCCGTCTAGTACGAGGTGTCTGCGAAAATCATCCGCTCCGTTCCCACCACCATGGCTGATGCCGCCACCGCACTCGCCTCCGCC[G/A]
CCGCTTCCGCCACTCTAACCCGATGTCTCCGTCTCCGCCGCCCTAGCCGAGACCGCCGCTGCCGCCGTCGCCGGGAGATAAGAGGAGTGGGAGGAGGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	5.90%	0.49%	0.00%	NA
All Indica	2759	89.50%	9.70%	0.80%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.10%	2.40%	0.50%	0.00%	NA
Indica II	465	77.80%	21.70%	0.43%	0.00%	NA
Indica III	913	88.50%	11.20%	0.33%	0.00%	NA
Indica Intermediate	786	91.60%	6.60%	1.78%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328066679	C -> T	LOC_Os03g49290.1	upstream_gene_variant ; 4482.0bp to feature; MODIFIER	silent_mutation	Average:77.664; most accessible tissue: Minghui63 root, score: 85.031	N	N	N	N
vg0328066679	C -> T	LOC_Os03g49300.1	upstream_gene_variant ; 2187.0bp to feature; MODIFIER	silent_mutation	Average:77.664; most accessible tissue: Minghui63 root, score: 85.031	N	N	N	N
vg0328066679	C -> T	LOC_Os03g49310.1	downstream_gene_variant ; 2457.0bp to feature; MODIFIER	silent_mutation	Average:77.664; most accessible tissue: Minghui63 root, score: 85.031	N	N	N	N
vg0328066679	C -> T	LOC_Os03g49300-LOC_Os03g49310	intergenic_region ; MODIFIER	silent_mutation	Average:77.664; most accessible tissue: Minghui63 root, score: 85.031	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328066679	NA	5.28E-09	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328066679	NA	1.73E-07	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328066679	NA	6.27E-07	mr1482	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328066679	3.49E-06	NA	mr1324_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328066679	4.22E-06	NA	mr1326_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328066679	4.41E-06	8.18E-06	mr1686_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328066679	4.23E-06	4.23E-06	mr1744_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251