Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328029053:

Variant ID: vg0328029053 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28029053
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAGTGGTGTGTAAGTGGGATGTAACTACTATGTAAATTTGTATAAATATATGAGAAGTGTCTCTTTTTTTTTCAAGAAAAGATGTTTGCTATGCTG[A/G]
ACTCCCGGCCTTAGCATACTATTATTTTAGCACTAATCTTAACGTCAATTCAATGCACCACAAACCGATATATTTTTAAGGGAAAAACTGTCGTAACTTT

Reverse complement sequence

AAAGTTACGACAGTTTTTCCCTTAAAAATATATCGGTTTGTGGTGCATTGAATTGACGTTAAGATTAGTGCTAAAATAATAGTATGCTAAGGCCGGGAGT[T/C]
CAGCATAGCAAACATCTTTTCTTGAAAAAAAAAGAGACACTTCTCATATATTTATACAAATTTACATAGTAGTTACATCCCACTTACACACCACTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	7.50%	1.42%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.11%	0.00%	NA
All Japonica	1512	73.30%	22.60%	4.03%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.10%	0.38%	0.00%	NA
Temperate Japonica	767	51.50%	42.10%	6.39%	0.00%	NA
Tropical Japonica	504	98.40%	1.00%	0.60%	0.00%	NA
Japonica Intermediate	241	90.50%	5.80%	3.73%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	7.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328029053	A -> G	LOC_Os03g49200.1	upstream_gene_variant ; 2441.0bp to feature; MODIFIER	silent_mutation	Average:81.875; most accessible tissue: Callus, score: 91.233	N	N	N	N
vg0328029053	A -> G	LOC_Os03g49210.1	upstream_gene_variant ; 351.0bp to feature; MODIFIER	silent_mutation	Average:81.875; most accessible tissue: Callus, score: 91.233	N	N	N	N
vg0328029053	A -> G	LOC_Os03g49200.2	upstream_gene_variant ; 2441.0bp to feature; MODIFIER	silent_mutation	Average:81.875; most accessible tissue: Callus, score: 91.233	N	N	N	N
vg0328029053	A -> G	LOC_Os03g49200-LOC_Os03g49210	intergenic_region ; MODIFIER	silent_mutation	Average:81.875; most accessible tissue: Callus, score: 91.233	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328029053	NA	6.55E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	2.01E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	2.68E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	1.37E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	3.14E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	2.82E-06	1.01E-07	mr1955	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	1.34E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	1.13E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	8.35E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	1.70E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328029053	NA	5.50E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251