Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328002759:

Variant ID: vg0328002759 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28002759
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGTCATGACTTTTTGTTAGAAAGATTTGGTGTGTGATAAACCAATAACCATACCTCCATCGAACAAAGAATGATTCCATTACGCTTAAAATATTAGC[T/C]
GTAATAAAATAAAATTGAACAAATTAAACAGATGTAAAGAAGAAAATTAAAGGGAAACTTATCGATGATACTACAAGCAAGCATGTTCATCGCCATGCAA

Reverse complement sequence

TTGCATGGCGATGAACATGCTTGCTTGTAGTATCATCGATAAGTTTCCCTTTAATTTTCTTCTTTACATCTGTTTAATTTGTTCAATTTTATTTTATTAC[A/G]
GCTAATATTTTAAGCGTAATGGAATCATTCTTTGTTCGATGGAGGTATGGTTATTGGTTTATCACACACCAAATCTTTCTAACAAAAAGTCATGACTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.50% 0.38% 0.00% NA
All Indica  2759 29.50% 70.00% 0.54% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.07% 0.00% NA
Aus  269 8.60% 91.10% 0.37% 0.00% NA
Indica I  595 4.40% 94.80% 0.84% 0.00% NA
Indica II  465 53.10% 46.20% 0.65% 0.00% NA
Indica III  913 30.70% 69.10% 0.22% 0.00% NA
Indica Intermediate  786 33.20% 66.20% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328002759 T -> C LOC_Os03g49150.1 downstream_gene_variant ; 1379.0bp to feature; MODIFIER silent_mutation Average:48.462; most accessible tissue: Callus, score: 81.737 N N N N
vg0328002759 T -> C LOC_Os03g49160.1 downstream_gene_variant ; 677.0bp to feature; MODIFIER silent_mutation Average:48.462; most accessible tissue: Callus, score: 81.737 N N N N
vg0328002759 T -> C LOC_Os03g49150.2 downstream_gene_variant ; 1380.0bp to feature; MODIFIER silent_mutation Average:48.462; most accessible tissue: Callus, score: 81.737 N N N N
vg0328002759 T -> C LOC_Os03g49150-LOC_Os03g49160 intergenic_region ; MODIFIER silent_mutation Average:48.462; most accessible tissue: Callus, score: 81.737 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328002759 NA 2.47E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.32E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.78E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 9.84E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 7.69E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.72E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.46E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 9.62E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.66E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 8.02E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.35E-08 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.07E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 5.00E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.75E-07 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.57E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.04E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.35E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.00E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.78E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 7.07E-07 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.23E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 6.15E-12 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 5.96E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 8.26E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.00E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 5.53E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.15E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.16E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.00E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.06E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.62E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.02E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.95E-10 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.75E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.91E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.07E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.12E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.80E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 6.74E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.83E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.62E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.88E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.32E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.42E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.70E-07 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 7.16E-09 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.44E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.06E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.27E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.96E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 8.34E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 7.95E-11 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.04E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.04E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.03E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.97E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.69E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.94E-09 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.19E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.02E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 6.61E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.11E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 6.68E-06 6.68E-06 mr1890 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 3.59E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.46E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 8.71E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 1.54E-06 1.54E-06 mr1941 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.12E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.73E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 4.19E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 1.56E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328002759 NA 2.91E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251