Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327982584:

Variant ID: vg0327982584 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27982584
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

CTATTCGGCAGACCCGCACTACAGCTTGCGCATACATCGAGTGGGTCGATACAGAAAATCCCGTTCTCGACCTAACCACTTGTTTACAAGAAGGTCGCTG[G/A]
TATTTCGCATCCGAAAGTACTGAGCAATACTTACGGAGAAAAGCGGCTTATGAACGACAATGTCGTGAACAACAGAGCGACTGGCGGGTGCTAACTACGG

Reverse complement sequence

CCGTAGTTAGCACCCGCCAGTCGCTCTGTTGTTCACGACATTGTCGTTCATAAGCCGCTTTTCTCCGTAAGTATTGCTCAGTACTTTCGGATGCGAAATA[C/T]
CAGCGACCTTCTTGTAAACAAGTGGTTAGGTCGAGAACGGGATTTTCTGTATCGACCCACTCGATGTATGCGCAAGCTGTAGTGCGGGTCTGCCGAATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	11.50%	0.04%	0.00%	NA
All Indica	2759	81.00%	19.00%	0.04%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	51.00%	48.80%	0.22%	0.00%	NA
Indica III	913	85.50%	14.50%	0.00%	0.00%	NA
Indica Intermediate	786	79.40%	20.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327982584	G -> A	LOC_Os03g49126.1	upstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0327982584	G -> A	LOC_Os03g49132.1	upstream_gene_variant ; 4853.0bp to feature; MODIFIER	silent_mutation	Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0327982584	G -> A	LOC_Os03g49120.1	downstream_gene_variant ; 621.0bp to feature; MODIFIER	silent_mutation	Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0327982584	G -> A	LOC_Os03g49120-LOC_Os03g49126	intergenic_region ; MODIFIER	silent_mutation	Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327982584	NA	3.42E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	6.32E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	3.57E-11	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	3.48E-11	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	7.47E-09	mr1241	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	1.18E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	5.28E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	1.51E-06	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	6.23E-07	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	2.41E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	6.42E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	3.33E-07	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	7.32E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	2.57E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	3.40E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	7.19E-07	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	5.40E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	3.82E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	2.16E-07	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584	NA	2.38E-06	mr1448_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251