Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327770292:

Variant ID: vg0327770292 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27770292
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTAGCGCCGTCCCCCTTCACATTTGTGACTTAACTTTCACTGGAGGGCTATGGGGACGCGCCAATGTCATTGGCGCCGTCATGTTGGACCTTGGCGCC[G/A]
TGAAAAAGATCATTTCTAGAATAAGTTTTTTTTAGAGATCTATTTGTAGGATAAGTTTTATAGAAGGATCAAAATGTGAAAACCCAGTGGTTTTTTACCA

Reverse complement sequence

TGGTAAAAAACCACTGGGTTTTCACATTTTGATCCTTCTATAAAACTTATCCTACAAATAGATCTCTAAAAAAAACTTATTCTAGAAATGATCTTTTTCA[C/T]
GGCGCCAAGGTCCAACATGACGGCGCCAATGACATTGGCGCGTCCCCATAGCCCTCCAGTGAAAGTTAAGTCACAAATGTGAAGGGGGACGGCGCTAACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	14.60%	0.68%	0.06%	NA
All Indica	2759	76.80%	22.70%	0.47%	0.00%	NA
All Japonica	1512	97.60%	1.90%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.00%	2.50%	0.50%	0.00%	NA
Indica II	465	50.50%	49.20%	0.22%	0.00%	NA
Indica III	913	80.70%	18.80%	0.44%	0.00%	NA
Indica Intermediate	786	72.50%	26.80%	0.64%	0.00%	NA
Temperate Japonica	767	98.70%	0.80%	0.52%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	90.50%	8.30%	1.24%	0.00%	NA
VI/Aromatic	96	62.50%	22.90%	11.46%	3.12%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327770292	G -> A	LOC_Os03g48710.4	upstream_gene_variant ; 4203.0bp to feature; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> A	LOC_Os03g48710.2	upstream_gene_variant ; 4203.0bp to feature; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> A	LOC_Os03g48710.3	upstream_gene_variant ; 3168.0bp to feature; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> A	LOC_Os03g48710.1	upstream_gene_variant ; 4203.0bp to feature; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> A	LOC_Os03g48720.1	downstream_gene_variant ; 841.0bp to feature; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> A	LOC_Os03g48730.1	downstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> A	LOC_Os03g48720-LOC_Os03g48730	intergenic_region ; MODIFIER	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N
vg0327770292	G -> DEL	N	N	silent_mutation	Average:55.35; most accessible tissue: Minghui63 panicle, score: 91.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327770292	8.33E-06	2.09E-10	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327770292	NA	5.47E-10	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327770292	NA	9.95E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327770292	1.59E-07	NA	mr1193_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327770292	NA	1.01E-08	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327770292	NA	5.26E-06	mr1448_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251