Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327596758:

Variant ID: vg0327596758 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27596758
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGTCCCGGTTTGTGTTACCAACCGGGACTAAAGATCATCTTTAGTCCCGGTTCGAATGCTGTCAGGACCTGTCAGGCCCCCCCGGGATCTTTAGTCCC[G/A]
GTTGGTAGCACCAACCGGGACTAAAGATCCCGGTGTCCCGGTTGGTAATACCAACCGGGACTAAAGATCTTGGTGATCTTTAAAGATCTTAACTTTAGTC

Reverse complement sequence

GACTAAAGTTAAGATCTTTAAAGATCACCAAGATCTTTAGTCCCGGTTGGTATTACCAACCGGGACACCGGGATCTTTAGTCCCGGTTGGTGCTACCAAC[C/T]
GGGACTAAAGATCCCGGGGGGGCCTGACAGGTCCTGACAGCATTCGAACCGGGACTAAAGATGATCTTTAGTCCCGGTTGGTAACACAAACCGGGACTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	0.70%	8.57%	18.92%	NA
All Indica	2759	79.60%	0.20%	1.70%	18.48%	NA
All Japonica	1512	71.50%	1.90%	20.97%	5.62%	NA
Aus	269	2.20%	0.00%	0.74%	97.03%	NA
Indica I	595	51.40%	0.00%	3.03%	45.55%	NA
Indica II	465	89.20%	0.20%	1.94%	8.60%	NA
Indica III	913	90.10%	0.20%	0.44%	9.20%	NA
Indica Intermediate	786	83.10%	0.30%	2.04%	14.63%	NA
Temperate Japonica	767	65.40%	3.30%	25.95%	5.35%	NA
Tropical Japonica	504	83.90%	0.00%	11.51%	4.56%	NA
Japonica Intermediate	241	64.70%	1.70%	24.90%	8.71%	NA
VI/Aromatic	96	50.00%	0.00%	27.08%	22.92%	NA
Intermediate	90	66.70%	1.10%	14.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327596758	G -> A	LOC_Os03g48450.1	upstream_gene_variant ; 3926.0bp to feature; MODIFIER	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N
vg0327596758	G -> A	LOC_Os03g48457.1	upstream_gene_variant ; 729.0bp to feature; MODIFIER	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N
vg0327596758	G -> A	LOC_Os03g48450.2	upstream_gene_variant ; 3972.0bp to feature; MODIFIER	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N
vg0327596758	G -> A	LOC_Os03g48450.3	upstream_gene_variant ; 3972.0bp to feature; MODIFIER	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N
vg0327596758	G -> A	LOC_Os03g48450.4	upstream_gene_variant ; 3972.0bp to feature; MODIFIER	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N
vg0327596758	G -> A	LOC_Os03g48450-LOC_Os03g48457	intergenic_region ; MODIFIER	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N
vg0327596758	G -> DEL	N	N	silent_mutation	Average:7.433; most accessible tissue: Callus, score: 18.506	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327596758	8.93E-06	4.41E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758	1.27E-06	5.92E-07	mr1252	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758	NA	1.22E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758	NA	1.03E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758	NA	2.20E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758	2.26E-07	2.28E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758	NA	5.05E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251