Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327557116:

Variant ID: vg0327557116 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27557116
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTAATGCTCTGTAGGACAGAGATGGTTAATGTTACCCATTCTCTCCATTTTTTTTCCCATCAACGAATGCTTATTATGAGAATAAGCATGTAACTGGA[C/T]
TGCCAATGGACTTCCTGCTGGATGTAGCAAGGCTGTGATTCTGTTTAGACTTAGTTCTTATCCCCTAATACAATGACGATATATTGTTCTTTCTCAATTT

Reverse complement sequence

AAATTGAGAAAGAACAATATATCGTCATTGTATTAGGGGATAAGAACTAAGTCTAAACAGAATCACAGCCTTGCTACATCCAGCAGGAAGTCCATTGGCA[G/A]
TCCAGTTACATGCTTATTCTCATAATAAGCATTCGTTGATGGGAAAAAAAATGGAGAGAATGGGTAACATTAACCATCTCTGTCCTACAGAGCATTACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	18.20%	0.06%	0.19%	NA
All Indica	2759	69.20%	30.40%	0.07%	0.33%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	50.90%	48.70%	0.34%	0.00%	NA
Indica II	465	49.50%	49.20%	0.00%	1.29%	NA
Indica III	913	91.10%	8.90%	0.00%	0.00%	NA
Indica Intermediate	786	69.10%	30.50%	0.00%	0.38%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327557116	C -> T	LOC_Os03g48400.1	upstream_gene_variant ; 51.0bp to feature; MODIFIER	silent_mutation	Average:31.719; most accessible tissue: Callus, score: 59.151	N	N	N	N
vg0327557116	C -> T	LOC_Os03g48390.1	downstream_gene_variant ; 2880.0bp to feature; MODIFIER	silent_mutation	Average:31.719; most accessible tissue: Callus, score: 59.151	N	N	N	N
vg0327557116	C -> T	LOC_Os03g48400-LOC_Os03g48410	intergenic_region ; MODIFIER	silent_mutation	Average:31.719; most accessible tissue: Callus, score: 59.151	N	N	N	N
vg0327557116	C -> DEL	N	N	silent_mutation	Average:31.719; most accessible tissue: Callus, score: 59.151	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327557116	2.84E-08	2.97E-10	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	5.86E-07	1.49E-10	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	NA	2.91E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	NA	4.37E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	NA	2.06E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	NA	3.77E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	4.43E-09	7.75E-12	mr1193_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116	1.46E-08	3.10E-13	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251