Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327523224:

Variant ID: vg0327523224 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27523224
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTGAATAAGACGAGTGGTCAAATAGTGCAAGCAAAAAGTCAAAATTTATATTATGAGACGGAGGGAGTATTTGGTTCGGTTTCTCTGCCCGTGCGT[T/C]
GATTTTTGTCTCACACTGGAGCTGCTCTTAGGGTGTGTTTAGTTCGTGAAAAGAAATTTTTTTAATAATACATAAATCTCCGTTGGATTTGTTTTGGATG

Reverse complement sequence

CATCCAAAACAAATCCAACGGAGATTTATGTATTATTAAAAAAATTTCTTTTCACGAACTAAACACACCCTAAGAGCAGCTCCAGTGTGAGACAAAAATC[A/G]
ACGCACGGGCAGAGAAACCGAACCAAATACTCCCTCCGTCTCATAATATAAATTTTGACTTTTTGCTTGCACTATTTGACCACTCGTCTTATTCAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.10%	28.80%	0.11%	0.00%	NA
All Indica	2759	64.00%	35.80%	0.14%	0.00%	NA
All Japonica	1512	99.00%	0.90%	0.07%	0.00%	NA
Aus	269	1.90%	98.10%	0.00%	0.00%	NA
Indica I	595	49.40%	50.40%	0.17%	0.00%	NA
Indica II	465	42.40%	57.20%	0.43%	0.00%	NA
Indica III	913	86.10%	13.90%	0.00%	0.00%	NA
Indica Intermediate	786	62.20%	37.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	64.60%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327523224	T -> C	LOC_Os03g48320.1	upstream_gene_variant ; 1732.0bp to feature; MODIFIER	silent_mutation	Average:49.163; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0327523224	T -> C	LOC_Os03g48330.1	upstream_gene_variant ; 1399.0bp to feature; MODIFIER	silent_mutation	Average:49.163; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0327523224	T -> C	LOC_Os03g48340.1	upstream_gene_variant ; 4734.0bp to feature; MODIFIER	silent_mutation	Average:49.163; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0327523224	T -> C	LOC_Os03g48320-LOC_Os03g48330	intergenic_region ; MODIFIER	silent_mutation	Average:49.163; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327523224	5.95E-08	2.71E-15	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224	1.72E-06	6.79E-10	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224	NA	1.91E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224	4.42E-10	7.45E-24	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224	3.66E-09	1.09E-12	mr1193_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251