Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327439642:

Variant ID: vg0327439642 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27439642
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAACATGCAAGTTCAAATTTAATTTCTACATCTCGCAACGAAAAAAATAAATTAAACTACAATCAAATTTGTTTTTTCCGTTGCGAGATGTAAAAGTT[G/A]
AATTTGTACTTGCATGTTTACAGAATGACATATCACATGTTAATACATCTTCTCAAATTTTTTTAATAACCATTTAAGTGACATATAAACAATAAGTGGA

Reverse complement sequence

TCCACTTATTGTTTATATGTCACTTAAATGGTTATTAAAAAAATTTGAGAAGATGTATTAACATGTGATATGTCATTCTGTAAACATGCAAGTACAAATT[C/T]
AACTTTTACATCTCGCAACGGAAAAAACAAATTTGATTGTAGTTTAATTTATTTTTTTCGTTGCGAGATGTAGAAATTAAATTTGAACTTGCATGTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 13.10% 0.08% 0.00% NA
All Indica  2759 95.70% 4.20% 0.04% 0.00% NA
All Japonica  1512 85.80% 14.00% 0.20% 0.00% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 92.00% 7.70% 0.22% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 6.00% 0.00% 0.00% NA
Temperate Japonica  767 73.70% 25.90% 0.39% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327439642 G -> A LOC_Os03g48190.2 upstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:40.237; most accessible tissue: Zhenshan97 flower, score: 56.224 N N N N
vg0327439642 G -> A LOC_Os03g48190.1 upstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:40.237; most accessible tissue: Zhenshan97 flower, score: 56.224 N N N N
vg0327439642 G -> A LOC_Os03g48200.1 downstream_gene_variant ; 1269.0bp to feature; MODIFIER silent_mutation Average:40.237; most accessible tissue: Zhenshan97 flower, score: 56.224 N N N N
vg0327439642 G -> A LOC_Os03g48220.1 downstream_gene_variant ; 4929.0bp to feature; MODIFIER silent_mutation Average:40.237; most accessible tissue: Zhenshan97 flower, score: 56.224 N N N N
vg0327439642 G -> A LOC_Os03g48190-LOC_Os03g48200 intergenic_region ; MODIFIER silent_mutation Average:40.237; most accessible tissue: Zhenshan97 flower, score: 56.224 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327439642 NA 1.49E-09 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 5.98E-16 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 3.84E-10 4.65E-27 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 2.16E-08 8.78E-12 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 6.69E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 2.62E-09 2.97E-28 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 1.35E-08 1.06E-11 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 2.30E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 1.80E-11 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 8.18E-17 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 8.36E-06 8.36E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 8.79E-11 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 2.48E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 6.54E-20 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 7.86E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 1.73E-08 1.52E-11 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 1.67E-06 5.19E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 5.12E-12 5.21E-34 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 6.65E-09 1.92E-12 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 2.73E-16 mr1649 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 6.22E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 3.97E-06 1.96E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 2.96E-06 9.48E-10 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 2.10E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 7.63E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 9.99E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 2.19E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 1.10E-16 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 9.39E-10 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 5.51E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 1.43E-07 4.60E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 7.41E-06 7.73E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 6.32E-12 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 1.89E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 6.62E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 3.87E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327439642 NA 2.08E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251